ID: 1179511608

View in Genome Browser
Species Human (GRCh38)
Location 21:41877475-41877497
Sequence CCTCATTTGCAAAGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 340}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179511608 Original CRISPR CCTCATTTGCAAAGTGTGGA TGG (reversed) Intronic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903404777 1:23087196-23087218 CCCAATCTGCAAAGTGTGAAGGG - Exonic
903659669 1:24969458-24969480 CCTCCTCTGAAAAGTGAGGAGGG - Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904763723 1:32824928-32824950 CCTCATTTACAAAATGGGAAAGG - Intronic
904917725 1:33982455-33982477 CCTCATTAGCAAACTGTGGAAGG + Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
909498625 1:76308598-76308620 TCTAATTTGCTAAGTGTTGATGG + Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912800463 1:112716659-112716681 CCCCATTTGAGATGTGTGGATGG - Intergenic
913441522 1:118903273-118903295 CCTCTTTTGCAAATTGATGATGG + Intronic
914885345 1:151580016-151580038 GCTCCTTTGCAAAGCCTGGAGGG - Intronic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915926336 1:160022789-160022811 GCTCCTTTGCACAGTGTGAATGG - Intergenic
916578443 1:166087365-166087387 CCTCCTTTGCAAAATGGAGATGG - Intronic
917791651 1:178502987-178503009 GGTCATCTGCATAGTGTGGATGG - Intergenic
918155820 1:181845598-181845620 CCTCCTTTCCAAATTCTGGATGG - Intergenic
918364432 1:183791691-183791713 CATCTTTTGATAAGTGTGGAAGG + Intronic
920056410 1:203196078-203196100 TTTCAGTTGCAAAGAGTGGAAGG + Intergenic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920534239 1:206727314-206727336 CTTCCTTTGTAAAGTGGGGATGG - Intronic
920907450 1:210184871-210184893 TCTCATTTGCTAAGAGTGCATGG + Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1063078936 10:2746501-2746523 CCTCAATTGTAAAATGTGGGTGG - Intergenic
1063539720 10:6919896-6919918 TCTCATTTGAAAAGTCAGGATGG + Intergenic
1063773476 10:9231707-9231729 CCTTATTTGCAAAGTACAGAAGG + Intergenic
1067251637 10:44591675-44591697 CCTCGTTTGCAAACTCTGAAAGG + Intergenic
1067756436 10:49009170-49009192 CCTCATTTGAAAAGTGGCTAGGG - Intergenic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067914462 10:50381692-50381714 GCTCATTTGCTGAGTGTGGTTGG - Intronic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1068884029 10:62079984-62080006 CCTCATTTTTAAAGTATGTAAGG + Intronic
1069589541 10:69633232-69633254 CAGCATTTCCAAAGTGTGGGTGG + Exonic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1069849905 10:71397737-71397759 CCCCATTTGGACAGTGGGGATGG + Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1071344551 10:84680215-84680237 CCTCTTTTGCACCCTGTGGATGG - Intergenic
1071400282 10:85261955-85261977 CCTCATTTGCAAAATAAGGTAGG + Intergenic
1071932499 10:90488253-90488275 CCTCTTATGTAAAGTGGGGAAGG - Intergenic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072630753 10:97144901-97144923 CCTCATCTGTAAAGTGTTGGGGG - Intronic
1073033335 10:100545976-100545998 CCTAATTTCCAAAATGTGGTTGG + Exonic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073451193 10:103610336-103610358 CCACATTTGGTAAGTGTGGAAGG + Intronic
1073680186 10:105694775-105694797 CCTCATTTACAAAATATGTAAGG + Intergenic
1074198307 10:111208432-111208454 CCTCATCATCAAAATGTGGAGGG - Intergenic
1074372991 10:112915419-112915441 CCTCATTTGTAATATGTGCAAGG + Intergenic
1074608917 10:115002573-115002595 CCTTTTTTGCAAAGTTTGGTTGG - Intergenic
1074815618 10:117139537-117139559 CCTCATTCACAAAGAGTGCAGGG + Intergenic
1074892209 10:117745025-117745047 CCTTATTGGCAAAATGAGGATGG + Intergenic
1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG + Intergenic
1076030380 10:127152717-127152739 GGCCATTTGCAAAGTCTGGAAGG - Intronic
1078407624 11:11084586-11084608 GCTCATTTGCCAAGTCTGGATGG + Intergenic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079554589 11:21743103-21743125 CCTCATTAGCAAAGTCAGAATGG - Intergenic
1079963779 11:26955483-26955505 CATCATTTGCAAAATGTTGATGG - Intergenic
1081361833 11:42189739-42189761 CCTCAGTTGGAAAATGTGGTAGG + Intergenic
1082201602 11:49377836-49377858 CCTTATTTGCAAGGAGTAGAGGG - Intergenic
1083459380 11:62800481-62800503 CTTCAACTGCAAAGGGTGGAAGG + Exonic
1083856683 11:65396502-65396524 CTTCCTTTGCAGAGTGGGGATGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1085257893 11:75186795-75186817 CCTCATCTAAAAAGTGTGCACGG + Intronic
1085569431 11:77546461-77546483 CCTCCTTTGTAAAGTGGAGATGG + Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1086270327 11:85055685-85055707 ATTCATTAGCAAAGTGGGGAAGG + Intronic
1086654067 11:89328389-89328411 CCTTATTTGCAAGGAGTAGAGGG + Intronic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1090491873 11:127171053-127171075 TCTCATTGGCAAAGTAGGGATGG - Intergenic
1090588014 11:128235126-128235148 CCTCATGTGGAAAGTAGGGATGG - Intergenic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091901477 12:4147507-4147529 CCTCATTTGCAAAACAAGGATGG + Intergenic
1092653946 12:10665178-10665200 CCTCATTTACAGCGTGTGAACGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1101034179 12:100688636-100688658 CATCCTTTGTAAAGTGCGGATGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1102958079 12:117072422-117072444 CCTCATCTGGAAAGTGAGCATGG - Intronic
1104652034 12:130542069-130542091 CCTTATTGGGAAAATGTGGATGG + Intronic
1106942122 13:34791017-34791039 CCTGGTTTGCAAACTCTGGATGG + Intergenic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1111975290 13:94960927-94960949 CCTGATTTTCAAAATGTGGTAGG + Intergenic
1114262668 14:21049606-21049628 GCTCATTTGCAACATGAGGAAGG - Intronic
1115505547 14:34090479-34090501 TTTCATTTGTAAAGTGTTGAGGG + Intronic
1115823718 14:37240816-37240838 CCACATTTTCAAAATTTGGAGGG - Intronic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116541536 14:46107726-46107748 CCTCATTTTCAAGCTGGGGAAGG - Intergenic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117222623 14:53621042-53621064 CCTCATGTGGAAAGTGTGGCTGG - Intergenic
1117303323 14:54449386-54449408 CATCACTGTCAAAGTGTGGAGGG + Intergenic
1118542370 14:66842314-66842336 GCTCATTCACAAAGAGTGGAAGG + Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118772719 14:68952839-68952861 CCCCAAATGGAAAGTGTGGATGG + Intronic
1119171694 14:72540686-72540708 CCTCATGTGCACAGTGTGATAGG + Intronic
1119408104 14:74411216-74411238 CCTTATCTGTAAGGTGTGGATGG + Intronic
1120011406 14:79419740-79419762 CCTCATTGACAAAATGAGGATGG + Intronic
1120133449 14:80835159-80835181 CCTCTTTTGCATTGTTTGGATGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1123800503 15:23814853-23814875 CCTCATTTGCTAAATGGAGATGG + Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125725228 15:41864879-41864901 CCTCATTTGCAAGGTAGGCAGGG + Intronic
1126928176 15:53614764-53614786 CCTCATTTACAAAATGAGGTGGG - Intronic
1128805322 15:70526585-70526607 GGTGATTTGCAAAGTGTGGGTGG - Intergenic
1129937701 15:79464441-79464463 CCTCATTTGTAAACTGAAGATGG - Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131533780 15:93216695-93216717 CTTCATTTGTAAAGTGAAGATGG + Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131999989 15:98168803-98168825 CCCCATTTGCAGAGTATTGAGGG - Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1133137119 16:3719875-3719897 CCTCATTTCCAAGGGGTGGAGGG + Intergenic
1133173599 16:3997533-3997555 CCTCATTTGCCATTTGTGGGCGG - Intronic
1133562185 16:6960581-6960603 CCTCCTCTGCAGAGTTTGGAAGG - Intronic
1133858613 16:9573318-9573340 CTGCAAATGCAAAGTGTGGATGG + Intergenic
1135421008 16:22305527-22305549 CCTCACTTGCAAAGTGGTGATGG + Intronic
1136116919 16:28100508-28100530 CCTCATTTGCCACGTGTGGCAGG - Intronic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138328479 16:56193616-56193638 CCTTATTGAGAAAGTGTGGAAGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1141553060 16:84819101-84819123 CCTCAGTCACAAAATGTGGACGG - Intergenic
1141705534 16:85662491-85662513 CCTCCTTTACAAAGTGAGTAGGG - Intronic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1143756780 17:9073171-9073193 CCGCATTTGCAAACAGTGGCTGG + Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144513039 17:15893939-15893961 ATTCATTTACAAAGTGTTGAAGG - Intergenic
1144566241 17:16361950-16361972 CATCATTTGCACATTGTGGATGG + Intergenic
1144636971 17:16916259-16916281 CCTCTTTTGCCAGGAGTGGAAGG + Intergenic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145969930 17:28950740-28950762 CCTAAATTGCAAAGAGGGGAGGG + Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1147441105 17:40447730-40447752 CCTAATTTTTAAAGTGGGGAGGG + Intronic
1148553973 17:48566835-48566857 CCTCATCTGGAAAGTGTTGGGGG - Intronic
1149440064 17:56666370-56666392 CCTCTGCTGCAAAGTGGGGAGGG + Intergenic
1149591824 17:57835632-57835654 GCTCATTTGTAATGTGTGGCTGG - Exonic
1150304691 17:64074432-64074454 CCTCATTCTGAAGGTGTGGAAGG + Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152288703 17:79426635-79426657 CCTCATTTCCAAATTTTGGAGGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154370943 18:13762616-13762638 CCTCAATTTCCAAGTGTGGATGG - Exonic
1155083582 18:22433481-22433503 CCTCATGAGCAAAGTGTTAAAGG - Intergenic
1155297646 18:24399679-24399701 TTTCATTTGCAAACTGTAGAAGG - Intergenic
1155390818 18:25334756-25334778 CCTCGTTTGCAAAGTCTCTAGGG - Intronic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157302851 18:46491950-46491972 TCTAATTTGAAAATTGTGGATGG - Intronic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1159448398 18:68568306-68568328 CCTCATTAAAAAAATGTGGATGG - Intergenic
1159491673 18:69143501-69143523 CATCCTTTTAAAAGTGTGGAAGG + Intergenic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1164248932 19:23459878-23459900 TCTCATTTGCTAAGTTGGGATGG + Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
1168318200 19:55493462-55493484 CCTCATTTGGATAGTGAAGATGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
926363540 2:12112627-12112649 TCGCATTTGTAAAGTGGGGATGG + Intergenic
927600062 2:24432899-24432921 CCTCATTTGCAAAATGCTGGGGG - Intergenic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930353585 2:50289309-50289331 CCTCATTTGCATTGTGAGAAGGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
931933915 2:67174076-67174098 CATTGTTTGCAAAGTGTGGGAGG + Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932617696 2:73245436-73245458 GCTCAGTAGCCAAGTGTGGATGG - Intronic
933411263 2:81928199-81928221 CCTCATTTGTAAAATATGAAAGG - Intergenic
935127146 2:100234671-100234693 TCTCATCTGCAACGTGTGGTTGG + Intergenic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
939010300 2:136838626-136838648 CCTCATTTTGAAAGGGAGGATGG - Intronic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
944324436 2:198387141-198387163 CCACATTTGCTGAGTCTGGATGG + Intronic
944635945 2:201676255-201676277 CCTCATTTCTAAAGTGAGGAAGG - Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
946326610 2:218987744-218987766 CCTCATTTGTAAAGTGGGTATGG + Intergenic
946465860 2:219911518-219911540 CCTCATTTGCAAAATAAAGATGG + Intergenic
946547099 2:220756275-220756297 CCCCATTTACAAATTGTAGAGGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169283747 20:4289931-4289953 CCTCATTTGTAAAGTGAGTCAGG - Intergenic
1169896421 20:10509510-10509532 CCTCATTTCCCAAGTGTGGTAGG + Intronic
1170032381 20:11956677-11956699 TCACATTCGCAAAGTGAGGATGG - Intergenic
1170301027 20:14884730-14884752 CCTCAATTCCAAAGGGAGGATGG - Intronic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171373088 20:24674228-24674250 CAGCATTTGCAAAGTGTTGATGG - Intergenic
1172101411 20:32485754-32485776 TCTCATTTTCAGAGTGAGGATGG - Intronic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173308751 20:41876874-41876896 CCTCATTTGCGAAGTGGGATAGG + Intergenic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174993896 20:55544104-55544126 CCTCAACTGCAAGGTGGGGAAGG + Intergenic
1175226372 20:57446474-57446496 CCTCATTTGTAACATGTGAATGG + Intergenic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1176342902 21:5714696-5714718 CCTCAACTGGAAAGTGTGGTGGG + Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176475156 21:7146847-7146869 CCTCAACTGGAAAGTGTGGTGGG + Intergenic
1176501925 21:7609760-7609782 CCTCAACTGGAAAGTGTGGTGGG - Intergenic
1176537223 21:8112765-8112787 CCTCAACTGGAAAGTGTGGTGGG + Intergenic
1178210172 21:30521202-30521224 CCTCATTTGCAAAGTTTCTAAGG + Intergenic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182093789 22:27613134-27613156 CCTCATTTGTCAAGTGAGCATGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1203242167 22_KI270733v1_random:29169-29191 CCTCAACTGGAAAGTGTGGTGGG + Intergenic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
951194768 3:19811952-19811974 CCTCATGTGCACTGTGGGGAGGG + Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
954544302 3:51419775-51419797 CATCATTTCCAAAGTATGGAGGG - Exonic
954812624 3:53257360-53257382 CCTCACTGGCCAAGTGTGGTGGG - Intergenic
955688766 3:61569877-61569899 CCTCCTTTGCAATGTGGGCAAGG - Intronic
956248867 3:67214762-67214784 ACTCATTACCAAAGTGTGAAGGG + Intergenic
956531757 3:70227767-70227789 CCTCATTTGTAAAACATGGAGGG - Intergenic
958900525 3:99880846-99880868 CATCATTTTCGTAGTGTGGATGG + Intronic
959969591 3:112394458-112394480 CATCATTGTCAAAGTGGGGAAGG - Intergenic
960885135 3:122385937-122385959 CTTCATTTATAAAGTGTGGGAGG - Intronic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
961770417 3:129245544-129245566 CCGCCTTTGCAAACTGTGAAGGG - Intergenic
961987756 3:131155861-131155883 CCTCAGTTTGAAAGTGAGGATGG - Intronic
962253632 3:133855352-133855374 CCTCAGTTTCAAAGTCTGTATGG + Intronic
962617692 3:137143646-137143668 CCTCATGGGCAAAGTGAAGATGG + Intergenic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
967654666 3:192032634-192032656 ATTCATTTGCAAATTGTGTATGG + Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
970795692 4:19910248-19910270 CATCATTTGTAAAGTCGGGATGG - Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971852440 4:31999931-31999953 CATGATTTCCAAAGTGTGCATGG - Intergenic
971903037 4:32687357-32687379 GCTCATTTTTAAAGTGTTGATGG - Intergenic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973267973 4:48230349-48230371 CTTCATTTGTAAAGTATGGAAGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
973971461 4:56217708-56217730 CCTGAATTGCAAAGGGAGGAAGG + Intronic
974669856 4:65015367-65015389 CCTGATTTCCAAAGGGAGGAAGG + Intergenic
976010682 4:80484919-80484941 CCTCAGCTGTAAAGTATGGAAGG + Intronic
977777918 4:100944102-100944124 CCTCATTTTTAAAGAGTGGTTGG - Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
980259815 4:130433651-130433673 CCTGAATTCCAAAGTGAGGAAGG - Intergenic
981848724 4:149201941-149201963 CCTCATTTATAAAGTTTGGCTGG - Intergenic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
984213734 4:176881964-176881986 CTTAATTTGGAAAGTGTGAAAGG + Intergenic
984556247 4:181217640-181217662 CCTCGTTTGGAAAGTGAGGTAGG + Intergenic
986856808 5:11878841-11878863 CATCATTTGCAAGGTGGGGAAGG + Intronic
986881799 5:12183076-12183098 CTTAATTTGGAATGTGTGGAAGG + Intergenic
987463979 5:18250617-18250639 CCTCTTTTGCTAAGTGTGCACGG - Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990683084 5:58268098-58268120 CCTCATTTGCAATCTGTTGGGGG + Intergenic
991504987 5:67315431-67315453 CTTCCTTTGCAAAGTGGGCATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992030388 5:72715287-72715309 CCTCATCAGCAATGTGAGGAAGG - Intergenic
992619411 5:78577745-78577767 TCTCGTTTAGAAAGTGTGGAAGG - Intronic
994859253 5:105167338-105167360 CCTGAATTGTAAAGGGTGGAGGG - Intergenic
995420452 5:111961087-111961109 CTTCACTTGCAAAGTGGGAAGGG - Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
995596838 5:113756387-113756409 CCTGAATTCCAAAGTGAGGAAGG - Intergenic
996525895 5:124479031-124479053 CCTCATTGTCTAATTGTGGAAGG - Intergenic
996951452 5:129131125-129131147 GGTCATTTTCAAAGTGTGGAGGG + Intergenic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998452354 5:142244791-142244813 CCTCATTTTCAAAGTGTGCTGGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000062379 5:157668926-157668948 GCTCATTTGTAAAGTGAGAATGG + Intronic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000437272 5:161228303-161228325 CTTCATTAGCAAAGTGTTAAAGG - Intergenic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001955775 5:175847282-175847304 CCTCATTTGCAAAGTTTTCCAGG - Intronic
1002077455 5:176717444-176717466 CCTCCTTTGTAAGCTGTGGAGGG - Intergenic
1004306475 6:14506061-14506083 CCCCATTTGCTAAGTGTAGCAGG - Intergenic
1004636002 6:17468278-17468300 CCTCATTGCCAAAGTGAGAAAGG - Intronic
1006374878 6:33666428-33666450 CCTATTTTGCAATGTGTGGATGG - Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008784845 6:55155989-55156011 CCTCATTTTGCAAGTGAGGATGG - Intronic
1008950913 6:57158058-57158080 CCCCATTTTATAAGTGTGGAAGG + Intronic
1010188911 6:73174739-73174761 CCTCACTGGCAAACTGGGGATGG + Intronic
1010601389 6:77831595-77831617 CATCATTTGCAGAGCATGGATGG + Intronic
1013348367 6:109284095-109284117 CCACATTTCCAATGTGTGGATGG + Intergenic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1016840025 6:148516701-148516723 CCTCATTTTCGAAATGAGGATGG - Intronic
1018513738 6:164555258-164555280 ACTGATTTGCAAAGCGAGGAGGG + Intergenic
1020459817 7:8416628-8416650 CTTCATTTACAAAGTGTGAATGG - Intergenic
1021088762 7:16455712-16455734 CCACATTTGAAAAGTGAGGGAGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022270332 7:28800876-28800898 TCTCTTTGGCAAAGTGTGAATGG + Intronic
1023505205 7:40892199-40892221 CATCAATAGCAAAGTGTGGAGGG + Intergenic
1023883371 7:44334356-44334378 CCTCATTTGCAAAGTGCTGCTGG - Intronic
1024160611 7:46671245-46671267 CCTGAATTCCAAAGGGTGGAGGG - Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026915139 7:74115621-74115643 CTCCATTTGCAAAGAGCGGATGG + Intronic
1027914268 7:84295061-84295083 CTTCAATTGCCAAGTTTGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1034388956 7:150767434-150767456 CATCATTTTCAAATTCTGGAGGG + Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035018868 7:155788736-155788758 GCTCATTGTCCAAGTGTGGATGG - Intergenic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036526375 8:9538621-9538643 CTTCCTTTGCAAGTTGTGGATGG + Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038531116 8:28318573-28318595 TCTCATTTGTAAAGTGTGGCAGG + Intronic
1040954409 8:52965028-52965050 CCTCACTTCCAAACTGTGCACGG + Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1041963542 8:63648130-63648152 CATCATTTGTAACGTGTTGACGG - Intergenic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044396310 8:91717025-91717047 CCTGAATTGAAAACTGTGGAAGG - Intergenic
1044542688 8:93425406-93425428 CATCATTTAAAAAGTGAGGAGGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045644272 8:104284920-104284942 CCTGAATTCCAAAGGGTGGAGGG + Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1050565654 9:6879762-6879784 CCTAATTTGTAAAATGTGGTTGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1054760661 9:69001347-69001369 CCACATTTGAAAAATGTGGGGGG - Intronic
1055159863 9:73113236-73113258 CTTCATTTGTAAATTGTTGAAGG + Intergenic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055887002 9:81075251-81075273 CCTCATTTTCAAAGTGTTGAAGG + Intergenic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059281355 9:113136693-113136715 CCTCATATGCATGGTCTGGATGG - Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1203458495 Un_GL000220v1:12246-12268 CCTCAACTGGAAAGTGTGGTGGG + Intergenic
1185687271 X:1939596-1939618 CCTCATCTGCAAAGTCAGGCAGG - Intergenic
1186103465 X:6181168-6181190 CCTCTTTTGACAAGTGTGTATGG + Intronic
1186323121 X:8452042-8452064 CCACAGTTCCACAGTGTGGAAGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187118433 X:16378894-16378916 CCTCATTTGTAAAATATGAACGG + Intergenic
1187378431 X:18778551-18778573 CCCAATTTGCAAAATGGGGATGG - Intronic
1188478234 X:30609991-30610013 CCTAATTTGCTTAGTGTGGAAGG + Intergenic
1188508143 X:30905762-30905784 CCTCAATTCCAAAGGGAGGAGGG - Intronic
1188825390 X:34826174-34826196 CCTCATTTCAAAATTTTGGAAGG + Intergenic
1189150962 X:38706184-38706206 CCTCATTTACAAAATGGTGAGGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190485112 X:50916303-50916325 GCTGATTTGGAAAGGGTGGAGGG - Exonic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194600568 X:95915798-95915820 CCTCAGTTGCAGAGAATGGATGG + Intergenic
1194647498 X:96475301-96475323 CCTGATTTTACAAGTGTGGAGGG - Intergenic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1196189225 X:112777590-112777612 AATCATTTGCAAAGTGAGGAAGG - Exonic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198484131 X:137069518-137069540 CATCATTTAGAAAGTGTGGAGGG + Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199669841 X:150135212-150135234 CGTCTTTTGCAAAATTTGGAGGG - Intergenic
1199767604 X:150952516-150952538 CCTCATTTCCACAGTGAGGAGGG - Intergenic
1202166121 Y:21990406-21990428 CCACATTCGCAAAGTGAGGCTGG - Intergenic
1202225237 Y:22595967-22595989 CCACATTCGCAAAGTGAGGCTGG + Intergenic
1202317876 Y:23599694-23599716 CCACATTCGCAAAGTGAGGCTGG - Intergenic
1202552890 Y:26070364-26070386 CCACATTCGCAAAGTGAGGCTGG + Intergenic