ID: 1179511776

View in Genome Browser
Species Human (GRCh38)
Location 21:41878697-41878719
Sequence GGACTCAGCTTCTCTAAACG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179511763_1179511776 29 Left 1179511763 21:41878645-41878667 CCAAAAGGCTTACGAAAATAAGG 0: 1
1: 0
2: 2
3: 8
4: 119
Right 1179511776 21:41878697-41878719 GGACTCAGCTTCTCTAAACGCGG 0: 1
1: 0
2: 1
3: 10
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179511776 Original CRISPR GGACTCAGCTTCTCTAAACG CGG Exonic
903983383 1:27206083-27206105 GGCCTCAGCTCCTCTGCACGTGG + Intergenic
905324856 1:37144389-37144411 GGAGTCAGCATCACTAAACTGGG + Intergenic
918764640 1:188463924-188463946 AAATTCAGCTTCTGTAAACGAGG - Intergenic
1070341772 10:75504583-75504605 GGAGTCATCTTCTCTAAGCAGGG + Intronic
1073305935 10:102503757-102503779 GTGCTCAGCATCTCTAAACTTGG + Intergenic
1075671112 10:124264787-124264809 TGACTCAGCTTCTCTCCAGGTGG + Intergenic
1090543567 11:127736169-127736191 TTAGTCAGCTTCTCTAAACGTGG - Intergenic
1091448707 12:559585-559607 GGACTCAGTTTCTCTATTAGAGG + Intronic
1091915993 12:4272210-4272232 GGAGCCAGCCTCTTTAAACGAGG - Intergenic
1096676192 12:53227415-53227437 GGGCTCAGCATCTCGAAAGGCGG + Exonic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1111210799 13:85076718-85076740 GTTATCAGCTTCTCTAAACTAGG - Intergenic
1114094916 14:19326923-19326945 TGACAAAGCTCCTCTAAACGTGG + Intergenic
1124007347 15:25805152-25805174 GGGTGCAGCTTCTCTACACGTGG - Intronic
1124716478 15:32067459-32067481 TGTCTCAGCTTCTCTAAAATTGG - Intronic
1130838421 15:87674365-87674387 AGACTCAGATTCACTAAATGTGG + Intergenic
1132064346 15:98718346-98718368 GGGTGCAGCTTCTCTAAACAAGG - Intronic
1132195297 15:99909980-99910002 GGAGTCTGCTTCTCTAAGGGTGG + Intergenic
1133664283 16:7950592-7950614 GAACTCAGCCTCTGTAAATGTGG - Intergenic
1138828103 16:60345625-60345647 GGACTCTGCTTCTCAAAATGTGG - Intergenic
1139105476 16:63822077-63822099 GGACCTAGCTTCTCTTAATGAGG - Intergenic
1139727113 16:68909734-68909756 TGAATCAGAATCTCTAAACGTGG - Intronic
1141161741 16:81633670-81633692 GGCCTCAGTTTCTCTGAAAGGGG - Intronic
1142386023 16:89765277-89765299 GGACTGAGGTCCCCTAAACGTGG - Intronic
1156767614 18:40677174-40677196 GAAGTCAGTTTCTCCAAACGTGG + Intergenic
1158263322 18:55633313-55633335 GGCCTCAGCTTCTCTCCATGTGG + Intronic
1159388201 18:67754666-67754688 GAACACAGCTCCTCTAAACAGGG + Intergenic
1162390945 19:10389924-10389946 GCACTCAGATTCTCTGAACGGGG - Intergenic
1166945313 19:46392473-46392495 GGCCTGAGCTTCTCTCAACGTGG + Intronic
1167446038 19:49538108-49538130 GGCCTCAGCTTCTCAGAAGGCGG - Intronic
926085850 2:10019999-10020021 GGACACAGCATCTCTAAAGGGGG - Intergenic
927307515 2:21590526-21590548 GGCCTCAGATTCTCTACAAGTGG - Intergenic
932162912 2:69479047-69479069 GGACTCAGATTCTCTCACCGGGG - Exonic
933637183 2:84721018-84721040 TGTCTCATATTCTCTAAACGCGG + Intronic
936046026 2:109188522-109188544 GGATGCCGCTTCTCTGAACGTGG - Intronic
938753705 2:134360708-134360730 GCCCTCAGCTTCTCAAAAGGGGG + Intronic
941708384 2:168684699-168684721 GATCTCAGCTTCTCAAAACCAGG + Intronic
1171257540 20:23701502-23701524 GGACTCAGCTTCTCTGCAGGAGG - Intergenic
1172253528 20:33496962-33496984 GGTCACTGCTTCTCTAAATGTGG + Intronic
1179511776 21:41878697-41878719 GGACTCAGCTTCTCTAAACGCGG + Exonic
1180485819 22:15795672-15795694 TGACAAAGCTCCTCTAAACGTGG - Intergenic
952445038 3:33372839-33372861 GGACTCTGCTTCTCAAAACGTGG + Intronic
952875763 3:37943124-37943146 CGACTCAGCATATCTAAATGGGG - Intronic
954536088 3:51360517-51360539 GGACTTAGCTTATCCAAACCTGG - Exonic
967850650 3:194080284-194080306 GGCCTCAGTTTCCCTAAATGAGG + Intergenic
971531503 4:27694683-27694705 AGGCTCAACTTCTCTAAATGGGG - Intergenic
974630938 4:64487938-64487960 GGACTCAGCTTCTATACAATAGG + Intergenic
978960629 4:114673461-114673483 TGACTCAGCTTATCTGAACAGGG - Intronic
984013512 4:174400244-174400266 GGACCCAGCCTCTCTAATGGAGG + Intergenic
985920952 5:2973144-2973166 GGACTCAGCATCTGTGAACTTGG - Intergenic
986521945 5:8628763-8628785 GGGCTCAGCTTGACTCAACGTGG + Intergenic
990373331 5:55143462-55143484 TGTCTCAGCTTCTCTAGATGTGG + Intronic
994093609 5:95829196-95829218 GGCCTCATTTTCTCTAAAAGTGG - Intergenic
1000340450 5:160273331-160273353 GAACACAGCTTCTCTAACAGAGG + Intronic
1002130706 5:177079852-177079874 AGACTCAGCCTCTCTAGACTTGG - Intronic
1002824909 6:763832-763854 TGACTCAGCCTCTCTAAGAGGGG + Intergenic
1005112774 6:22302422-22302444 AGACTCAGTTTCTCTAAAAATGG + Intergenic
1011683144 6:89802236-89802258 GGTCTGAGCTTTTCTAAAAGGGG - Intronic
1015732731 6:136364750-136364772 GGCCTCAGCTTCTCCACACATGG - Intronic
1015767675 6:136736257-136736279 GGATTCAACATCTCTAAAAGAGG + Intronic
1019315461 7:382080-382102 GGACTCAGAGTCTCTAAGCAGGG + Intergenic
1024512062 7:50212267-50212289 GGTCTCAGCTTCCCTAAGCCTGG - Intergenic
1025925951 7:65960573-65960595 GGAACCAGCTGCTCTGAACGTGG + Intergenic
1026167396 7:67922482-67922504 GGCCTCAGCTTCCCCAAATGCGG - Intergenic
1027432939 7:78133015-78133037 GGACTCTGCTTCTCTGAGCTGGG + Exonic
1027877791 7:83793473-83793495 TGTCTCAGCTTCTCCAAACTTGG - Intergenic
1027992972 7:85386753-85386775 AGACTCAGGTTCTCTAAGCTTGG - Intergenic
1029819813 7:103135865-103135887 TAACTCAGCCTCTCTAAACTTGG + Intronic
1030834541 7:114265900-114265922 GGACACTGCTTCTCGAAACCAGG - Intronic
1041657896 8:60372455-60372477 TGACTTAGCTTCTTTAATCGGGG - Intergenic
1045336280 8:101206208-101206230 GGACCCAGCGGCTCTGAACGCGG + Intergenic
1050354479 9:4769866-4769888 GGTCAAAGCTGCTCTAAACGGGG + Intergenic
1051428305 9:16957136-16957158 GGACTCAGCTTCAGAAGACGGGG - Intergenic
1058147287 9:101425997-101426019 CTACTCAGCTTCTGTAAACATGG - Intronic
1062476499 9:136730265-136730287 GGACTCAGTATCTCTGAAGGAGG - Intergenic
1186198303 X:7131494-7131516 GGTCTCAGCTTCTCTCCACGTGG - Intronic
1186850978 X:13579848-13579870 GGCCTCAGCTTCTCTCTATGTGG + Intronic
1187258983 X:17667851-17667873 GGAGGCAGCTTCCCTAAGCGGGG + Intronic
1190204430 X:48391715-48391737 GGTCTCAGCCTCTCTAAACCAGG + Intronic
1190206106 X:48403688-48403710 GGTCTCAGCCTCTCTAAACCAGG - Intronic
1196940255 X:120768626-120768648 AGACCTAGCTTCTCTAAACTTGG - Intergenic