ID: 1179511896

View in Genome Browser
Species Human (GRCh38)
Location 21:41879011-41879033
Sequence CGCGCAGGGCGATCCCGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 52}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179511881_1179511896 17 Left 1179511881 21:41878971-41878993 CCAGGAGCGCCCGCGGCGGCGGG 0: 1
1: 0
2: 4
3: 36
4: 468
Right 1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 52
1179511886_1179511896 7 Left 1179511886 21:41878981-41879003 CCGCGGCGGCGGGACCCGGCGGG 0: 1
1: 0
2: 3
3: 37
4: 219
Right 1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 52
1179511878_1179511896 21 Left 1179511878 21:41878967-41878989 CCGGCCAGGAGCGCCCGCGGCGG 0: 1
1: 0
2: 5
3: 17
4: 194
Right 1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 52
1179511891_1179511896 -7 Left 1179511891 21:41878995-41879017 CCCGGCGGGCGGGCGGCGCGCAG 0: 1
1: 2
2: 13
3: 56
4: 361
Right 1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 52
1179511877_1179511896 22 Left 1179511877 21:41878966-41878988 CCCGGCCAGGAGCGCCCGCGGCG 0: 1
1: 0
2: 2
3: 37
4: 218
Right 1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 52
1179511892_1179511896 -8 Left 1179511892 21:41878996-41879018 CCGGCGGGCGGGCGGCGCGCAGG 0: 1
1: 0
2: 5
3: 44
4: 318
Right 1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 52
1179511884_1179511896 8 Left 1179511884 21:41878980-41879002 CCCGCGGCGGCGGGACCCGGCGG 0: 1
1: 0
2: 3
3: 24
4: 278
Right 1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179511896 Original CRISPR CGCGCAGGGCGATCCCGGAG CGG Exonic
900302138 1:1983121-1983143 CACGGAGAGCGATCACGGAGGGG + Intronic
901064949 1:6490145-6490167 GGGGCAGGGGGATCCTGGAGGGG - Intronic
901065204 1:6490979-6491001 GGCTCAGGGCGATTCCGGGGCGG - Intronic
904050215 1:27634306-27634328 CGCGGAGGGGGCGCCCGGAGAGG + Intronic
907962530 1:59296811-59296833 TGAGCAGGGCGGTCCCGGGGCGG - Intronic
1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG + Intronic
1084296206 11:68214389-68214411 CGCGCAGGGCACACCCGGAGTGG - Intergenic
1090710013 11:129375698-129375720 CGCGCAGGTCGGCGCCGGAGTGG + Intergenic
1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG + Exonic
1107605156 13:42049037-42049059 CGCGCCGGGCGATCCCGGGAAGG + Intronic
1113379430 13:109787758-109787780 GGCGCAGGGCGCTCCTGGGGTGG - Intergenic
1120847458 14:89138963-89138985 CACGCAGGGCAATCCCACAGTGG - Intronic
1122460634 14:101891723-101891745 CGGGAAGGGCGAGCCTGGAGCGG - Intronic
1131437992 15:92438262-92438284 CGTGCAGGGCGACCCTGGATAGG + Intronic
1132709570 16:1260361-1260383 CACGCAGGGCGAGACGGGAGTGG - Intergenic
1134279383 16:12803973-12803995 CGCGCAGGTCGATCCCAGAGGGG - Exonic
1136386005 16:29926290-29926312 CTCGCTGGGGGATCCCGTAGAGG + Exonic
1142752878 17:1998761-1998783 CGCGCACGGGGACCCCGGGGTGG + Intronic
1143627474 17:8118784-8118806 GGCCCAGGGCGGTCCTGGAGCGG - Exonic
1145750721 17:27353638-27353660 GGCGCAGGGCGGGCCCCGAGGGG - Intergenic
1146719917 17:35116961-35116983 CCCGCAGGGAGATCGTGGAGTGG - Exonic
1147450592 17:40501676-40501698 CGTGCAGGGCCCGCCCGGAGGGG - Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1152768812 17:82155264-82155286 CGCGCCGGGCGACCACGGATGGG - Intronic
1153040789 18:811943-811965 CCCGCCGGGCGATCCGGGGGAGG + Intronic
1160764303 19:800541-800563 CCCGCAGGGCGAGCCCACAGTGG + Intronic
1161791907 19:6365013-6365035 CGCGCTGGGCCAGCCGGGAGTGG + Intronic
1163439748 19:17316119-17316141 TGCCCTGGGCGATCCAGGAGAGG + Intronic
1165507892 19:36245886-36245908 CTCGCGGGGCGATCCCGGTCGGG - Intronic
1166699836 19:44875893-44875915 CGCGCCAGGCGAGCCCAGAGCGG - Intronic
1168528515 19:57106903-57106925 GGCGCAGGCGGAGCCCGGAGAGG + Intergenic
1168694492 19:58396844-58396866 GGCCCAGGGCGACCCCGGCGGGG - Exonic
926718582 2:15942571-15942593 CGGGCAGGGCGGCCCCGGCGCGG - Exonic
947801115 2:232928808-232928830 CGGGCAGGGCAACCCAGGAGAGG - Intronic
1172359715 20:34303432-34303454 CGCGCAGGGCGGAGCCGGAGGGG + Intronic
1173589244 20:44211122-44211144 AGCGCAAGGAGATCCCGGGGCGG - Intergenic
1174393643 20:50233264-50233286 CGGGCAGGGAGACCCAGGAGAGG - Intergenic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1178680566 21:34669736-34669758 CGCGCAGGGCGAGCCCCGCGGGG + Exonic
1178916362 21:36707709-36707731 TGCCCAGGGCGTTCCCGGGGAGG + Intronic
1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG + Exonic
1181637469 22:24181146-24181168 CATGCAGGGCGAGCCCGGCGGGG - Intergenic
954110198 3:48429299-48429321 CGCGGAGCCCGAGCCCGGAGCGG - Exonic
962817942 3:139019895-139019917 CACGGAGGGCGTTCCGGGAGCGG + Exonic
964509735 3:157437691-157437713 CGCGCCGGGGGCTCCCGCAGAGG + Exonic
968293642 3:197556800-197556822 GGCGCAGGGCGATAGCGCAGTGG - Intronic
968506630 4:973932-973954 CGCGCAGGACGCCCCCGGCGAGG + Intronic
973576942 4:52299103-52299125 CCAGCAGGGCTATCCCAGAGAGG + Intergenic
976874494 4:89837041-89837063 CGCCCAGGACGCTCTCGGAGGGG + Intronic
985580452 5:693131-693153 CGCGCGGGGCGGTCCGGGAAGGG + Intronic
986313675 5:6572318-6572340 TGTGCAGGGCGATCCCGCACAGG + Intergenic
1004561830 6:16760090-16760112 CGCGCAGGCCGGTCCCGCAGGGG - Intronic
1004650135 6:17600448-17600470 CGGGCAGGACGATGGCGGAGGGG + Exonic
1007783222 6:44265679-44265701 CGGGAAGGGGGATTCCGGAGGGG - Exonic
1023810158 7:43906001-43906023 CGACCAAGGAGATCCCGGAGCGG + Intronic
1047731959 8:127735691-127735713 CGCGCAGTGCGTTCTCGGTGTGG + Intronic
1062491819 9:136808447-136808469 CCCGCCGGGCGCTCCGGGAGCGG + Intronic
1185750781 X:2608763-2608785 CGCTCAGGGCGATCCCCAAGGGG - Intergenic
1191830234 X:65407692-65407714 CGCGCACGCGGATCCCCGAGGGG + Intronic
1198210599 X:134512325-134512347 AGGGCAGGGAGATCCCGGAGTGG + Intronic
1200964838 Y:9026403-9026425 CTCGCAGGGCTATCCAGGAAAGG + Intergenic