ID: 1179512034

View in Genome Browser
Species Human (GRCh38)
Location 21:41879437-41879459
Sequence CGCCCCGCAGTCCCACCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 151}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179512034_1179512042 1 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512042 21:41879461-41879483 GGGCGGCGTGGACGGGGCAGCGG 0: 1
1: 0
2: 6
3: 71
4: 650
1179512034_1179512045 12 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512045 21:41879472-41879494 ACGGGGCAGCGGGCGCGCGCGGG 0: 1
1: 0
2: 5
3: 45
4: 490
1179512034_1179512048 17 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512048 21:41879477-41879499 GCAGCGGGCGCGCGCGGGGCGGG 0: 1
1: 1
2: 11
3: 119
4: 740
1179512034_1179512049 22 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512049 21:41879482-41879504 GGGCGCGCGCGGGGCGGGTCTGG 0: 1
1: 1
2: 21
3: 157
4: 871
1179512034_1179512039 -7 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512039 21:41879453-41879475 CGGGGCGCGGGCGGCGTGGACGG 0: 1
1: 0
2: 4
3: 69
4: 594
1179512034_1179512051 29 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512051 21:41879489-41879511 CGCGGGGCGGGTCTGGCCGGAGG 0: 1
1: 1
2: 5
3: 42
4: 323
1179512034_1179512050 26 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512050 21:41879486-41879508 GCGCGCGGGGCGGGTCTGGCCGG 0: 1
1: 0
2: 8
3: 167
4: 846
1179512034_1179512043 2 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512043 21:41879462-41879484 GGCGGCGTGGACGGGGCAGCGGG 0: 1
1: 0
2: 1
3: 43
4: 378
1179512034_1179512052 30 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512052 21:41879490-41879512 GCGGGGCGGGTCTGGCCGGAGGG 0: 1
1: 0
2: 4
3: 25
4: 283
1179512034_1179512041 -5 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512041 21:41879455-41879477 GGGCGCGGGCGGCGTGGACGGGG 0: 1
1: 1
2: 8
3: 89
4: 573
1179512034_1179512044 11 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512044 21:41879471-41879493 GACGGGGCAGCGGGCGCGCGCGG 0: 1
1: 0
2: 13
3: 77
4: 421
1179512034_1179512040 -6 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512040 21:41879454-41879476 GGGGCGCGGGCGGCGTGGACGGG 0: 1
1: 0
2: 9
3: 60
4: 527
1179512034_1179512046 13 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512046 21:41879473-41879495 CGGGGCAGCGGGCGCGCGCGGGG 0: 1
1: 2
2: 9
3: 83
4: 548
1179512034_1179512047 16 Left 1179512034 21:41879437-41879459 CCTGCGGGTGGGACTGCGGGGCG 0: 1
1: 1
2: 0
3: 13
4: 151
Right 1179512047 21:41879476-41879498 GGCAGCGGGCGCGCGCGGGGCGG 0: 1
1: 0
2: 14
3: 84
4: 690

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179512034 Original CRISPR CGCCCCGCAGTCCCACCCGC AGG (reversed) Exonic
902554836 1:17240782-17240804 AGCCCCGCAGACCCCCCAGCAGG - Intronic
903846296 1:26281458-26281480 GGCCCCGCAGTCCCTCTCCCAGG + Exonic
914428532 1:147599991-147600013 CGGCCCGACGTCCCGCCCGCGGG - Intronic
914702792 1:150149878-150149900 CACCCCGCAGCTCCATCCGCGGG - Intronic
915217626 1:154350579-154350601 CGCCCCTCAGGCCCAGCCTCTGG + Exonic
918044919 1:180935841-180935863 AGCCCCGCAGTCGCAGTCGCGGG - Exonic
920333392 1:205228163-205228185 CGCCCCGCAGCCCGGCCGGCCGG + Exonic
922416607 1:225428056-225428078 CGCCCCGCAGTCCCGCAAGCCGG + Intronic
922518155 1:226223600-226223622 CGCCCCGCCTTCCCAGCCCCTGG + Exonic
923475388 1:234326727-234326749 CGCCCCGCTGTTCCATCCGCAGG - Intergenic
1067096896 10:43307475-43307497 CCCCCCGCAGACCCAGCTGCTGG + Intergenic
1070805602 10:79268980-79269002 CCCCTCCCTGTCCCACCCGCTGG - Intronic
1070819606 10:79347327-79347349 CGCTCCGCGGCCCCACCGGCTGG + Intergenic
1073107138 10:101038666-101038688 AGCCCACCAGTCCCACCTGCAGG - Exonic
1075054510 10:119207546-119207568 CTCCCCTCAGTCCCTCCCGGGGG - Intergenic
1076807782 10:132867795-132867817 GGCCCCGCTGTGCCTCCCGCGGG + Intronic
1077056963 11:598467-598489 CGCCGCGCACTCCCGCCCGACGG + Exonic
1077060278 11:614928-614950 CGCTCCGCAGTCTCAGCCTCGGG + Exonic
1077103737 11:833136-833158 AGCCCCGGAGGCCCAGCCGCAGG + Intronic
1077168302 11:1153494-1153516 TGCCCGGGAGTCCCACCCACCGG - Intergenic
1080012341 11:27472049-27472071 CGCCCCGCGGCGCCCCCCGCTGG + Intronic
1083886238 11:65574639-65574661 CACCCCTCCCTCCCACCCGCGGG - Intergenic
1084087107 11:66859808-66859830 CGCCCTGCAGGCCCACGTGCTGG + Exonic
1084561868 11:69910022-69910044 CTCCCCACAGTCCCTCCCACAGG + Intergenic
1084692237 11:70734154-70734176 TGCCCGGCACTCCCTCCCGCGGG - Intronic
1085123622 11:73982890-73982912 CGCCCCGCAGGCCCCACCCCGGG - Exonic
1085520843 11:77138158-77138180 CCCCTCGCCGTCCCGCCCGCGGG + Intronic
1088595753 11:111439043-111439065 TGTCCCGCACACCCACCCGCTGG + Intronic
1090817833 11:130314597-130314619 CTCCTCGCACTCCCACTCGCGGG - Exonic
1091550318 12:1531063-1531085 CGGCGCGCAGACCCACCCGGCGG - Intronic
1093741394 12:22693326-22693348 GGCCCCGCACTCCGAGCCGCCGG - Intergenic
1103509810 12:121466862-121466884 CGCCCGGCAGGCCCGCCCGACGG + Intronic
1104892872 12:132148750-132148772 CGCCCCTCACCCCCACCTGCCGG + Intronic
1104913454 12:132251652-132251674 CTCCCCGCAGGCCCAGCCCCCGG + Intronic
1111964294 13:94845649-94845671 CCCCCAGCCCTCCCACCCGCAGG - Intergenic
1122415406 14:101547319-101547341 CTCCCCGCAGCCCCACTCCCTGG - Intergenic
1122783649 14:104154240-104154262 AGCACCCCCGTCCCACCCGCTGG - Intronic
1123051918 14:105548111-105548133 CGCCCCCCACCGCCACCCGCCGG + Intergenic
1128141075 15:65301357-65301379 CGGCCCGCAGTCCGAGCGGCCGG - Intergenic
1129217159 15:74107047-74107069 CTCCCCCCAGTCCCTCCAGCAGG - Intronic
1129470688 15:75751810-75751832 CTCCCCCCAGTCCCTCCAGCAGG + Intergenic
1130335226 15:82952474-82952496 GGCCCCGCAGTCCCTCCGGAGGG + Intronic
1132689813 16:1177428-1177450 CGCCCCGGAGTCCCCCAAGCTGG + Intronic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1133304859 16:4802490-4802512 CGCCCCGCCGGCCCGCCCGCTGG + Intronic
1136276206 16:29180717-29180739 TGCCCTGGAGTCCCTCCCGCAGG - Intergenic
1136570344 16:31093159-31093181 CTCCCCACATCCCCACCCGCAGG + Intronic
1137003997 16:35255618-35255640 CGCCCTCCGCTCCCACCCGCGGG + Intergenic
1138106333 16:54288860-54288882 CGCCCCCCCCCCCCACCCGCCGG - Intergenic
1140393296 16:74606796-74606818 CGGGCCGGAGGCCCACCCGCCGG + Exonic
1141158743 16:81614633-81614655 CACACCACAGTCCCACACGCAGG - Intronic
1141721567 16:85758911-85758933 GGCCCCGCAGTCCCAAAGGCTGG + Intergenic
1141746279 16:85928720-85928742 CACCCAGCAGTTCCACCCACAGG - Intergenic
1141943245 16:87292596-87292618 CCCCCAGCAGTCCCACACCCTGG - Intronic
1142080585 16:88146776-88146798 TGCCCTGGAGTCCCTCCCGCAGG - Intergenic
1142120324 16:88383616-88383638 CTCCCCGCAGCCCCGCCCGGAGG - Intergenic
1142176222 16:88646679-88646701 CTCCCCACTGTCCCACCGGCCGG - Intronic
1144853922 17:18257944-18257966 CACCCCGCCGCCCCACCCACTGG + Intronic
1146453751 17:32994098-32994120 CGCCACGCTGTCCCACCCCTTGG - Intronic
1147643214 17:42017649-42017671 CACCCCGCCTTCCCACCCACGGG - Exonic
1151321363 17:73354527-73354549 AGCCCCGCACTGCCACCAGCAGG - Intronic
1152088930 17:78236492-78236514 GGCCCCCCAGTCCCAGCTGCAGG + Intronic
1152233278 17:79125522-79125544 CGGCCCGTTGTCCCACACGCAGG - Intronic
1152683692 17:81683500-81683522 CCCCCCGCAACTCCACCCGCGGG + Intronic
1152926987 17:83091934-83091956 CGCCCCGCATTCCTACACTCGGG - Intronic
1159957686 18:74531280-74531302 CGCCCTGCAGTCACACCCAGTGG - Intergenic
1160406767 18:78651735-78651757 GGCCCTGCAGTCCCATCCTCAGG - Intergenic
1160863958 19:1249196-1249218 GGCCCCGCGCGCCCACCCGCCGG - Intronic
1161001681 19:1914014-1914036 CCCACCTCAGTCCCACCCCCAGG - Intronic
1162088013 19:8260098-8260120 AGCCCTGCAGCCCCACCAGCTGG - Intronic
1162870354 19:13581629-13581651 GTTCCCGCAGGCCCACCCGCAGG + Intronic
1162969068 19:14169428-14169450 TTCCCCGCTGTCCCAGCCGCGGG + Intronic
1165049547 19:33132652-33132674 CTCCCCGCACTGCCACCTGCTGG + Intronic
1165713033 19:38025482-38025504 CGCCCTGCAGTCCCTCATGCAGG - Intronic
1165996320 19:39846415-39846437 CACCCCGTAGTCCCGCCCCCGGG + Intergenic
1167166900 19:47804657-47804679 TGCCCTGCAGTCCCGCCCCCTGG + Intronic
1167174938 19:47859107-47859129 TGCCCTGCAGTCCCGCCCCCTGG - Intergenic
1168567302 19:57435714-57435736 CGCACCGCAGTCCCAGTCCCGGG - Intronic
927205346 2:20605583-20605605 CTCCCCGCACTCCCAGCCCCTGG + Intronic
927713881 2:25341073-25341095 CGCCCCGCACCCCCAGCCACAGG + Intronic
929567535 2:42999274-42999296 AGCCCCAGAGTCCCACCTGCTGG + Intergenic
930847576 2:55922812-55922834 TGCCCCCCAGTCCCACACCCCGG + Intronic
932288159 2:70553931-70553953 CGCCCCGCAGCGCTGCCCGCCGG + Exonic
933060852 2:77735020-77735042 CACCCCGCAGTCCGAGCGGCCGG - Intergenic
935820459 2:106887532-106887554 CTCCCCGCGGCCCCGCCCGCAGG - Intergenic
937283493 2:120736083-120736105 CGCCGCGCAGCCCCTACCGCCGG - Intronic
938017059 2:127876046-127876068 CGCCCCGCCCCCCCACCCGCTGG + Intronic
940420601 2:153476876-153476898 CGCCCCCCGGCCCCACCCGTGGG + Intergenic
941916715 2:170818087-170818109 CCCCCCGCTGGCCCACACGCCGG + Intronic
945833110 2:214809675-214809697 CGGCCCGCCGTCCCAGACGCGGG - Exonic
945833170 2:214809856-214809878 CTCCCCTAAGTCCCACACGCCGG - Intergenic
948047059 2:234952500-234952522 CACCCCGCAGGGCCGCCCGCCGG - Intronic
1169143678 20:3239332-3239354 CGCCCCGCGCCCTCACCCGCGGG + Intergenic
1169171883 20:3471553-3471575 CGCCCCTCAGCCCCAGCCTCTGG - Intronic
1171452933 20:25248485-25248507 CGCCCCGCAGAGACCCCCGCTGG - Intronic
1173256997 20:41400814-41400836 GACCCCGCAGTCCCACCAGCTGG - Intergenic
1173827746 20:46058210-46058232 CTCCCCGCAGTGCCCCCAGCGGG - Intronic
1174174516 20:48636417-48636439 GGCCCCGCTGGCCCACCCACTGG - Intronic
1179437107 21:41369586-41369608 AGCCCAGCACTCCCACCTGCTGG - Intronic
1179512034 21:41879437-41879459 CGCCCCGCAGTCCCACCCGCAGG - Exonic
1180108252 21:45633902-45633924 CTCTCCTCAGTCCCACCAGCAGG - Intergenic
1180108330 21:45634313-45634335 CTCTCCTCAGTCCCACCAGCAGG - Intergenic
1181038828 22:20182388-20182410 GGCCCCTCCGTCCCACCCCCTGG - Intergenic
1181776787 22:25165866-25165888 CACCCCCCAGTCCCTCCCACTGG - Intronic
1184143267 22:42592192-42592214 CTCCCCGCAGTCTCAGGCGCAGG - Intronic
1185342942 22:50299737-50299759 CGCCACCCAGCCCCACCCACCGG + Intronic
1185381298 22:50508478-50508500 CGCCCCGCAGCCCCACCCGCCGG - Intronic
952651887 3:35737296-35737318 CTCCCCGCAGCCCCAACAGCAGG + Exonic
954004007 3:47578289-47578311 CGCCCCGAAGTCTCACCCTCAGG + Intronic
954778944 3:53045567-53045589 GGCCCCGCGGTCCCGCGCGCCGG - Intronic
960844408 3:121993390-121993412 GGCCCCGCAGGCCCAGCCCCCGG - Exonic
961692653 3:128681137-128681159 CGCCCCAGGGTCCCACACGCGGG + Intergenic
962198038 3:133380181-133380203 CCCCCCGCACTACCACACGCAGG + Exonic
962498416 3:135965706-135965728 CGCCCCGCCCAGCCACCCGCAGG - Exonic
968471681 4:785564-785586 CGCCCCGCAGGGCCACCAGGTGG + Exonic
968556447 4:1248506-1248528 GGCCCCGCAGGCCCAGCCACGGG + Intronic
968898328 4:3418188-3418210 GGCCCTGCAGCCCCACCCCCTGG - Intronic
975779005 4:77819745-77819767 CGCCCCGCATCCCCTCCGGCCGG - Intergenic
982033776 4:151325740-151325762 CGCCCCACAGCCACACACGCTGG + Intergenic
984823701 4:183906178-183906200 CGGCCCGCAGTCCCCGGCGCTGG - Exonic
986190847 5:5494897-5494919 CGCCCCGCAGGCCTGCCGGCAGG + Intergenic
986405524 5:7421078-7421100 CGCCCACCAGTCCCACCGGAAGG + Intronic
990308804 5:54518582-54518604 CCCCCCGCAGCACCACCCGTCGG + Exonic
994754628 5:103779055-103779077 GGCCCCGCACTCCCTGCCGCCGG - Intergenic
995206650 5:109488032-109488054 CCCCCAGCAGTTCCGCCCGCCGG - Intergenic
999896772 5:156042698-156042720 CTCCCCCCAGGCCCACCAGCTGG - Intronic
1002526095 5:179816938-179816960 CGCCTCTCAGCCCCTCCCGCCGG + Intronic
1005584390 6:27261343-27261365 CCCCCCCCACTCCCCCCCGCGGG - Intergenic
1011193694 6:84762605-84762627 CTCCCTGCAGATCCACCCGCGGG + Exonic
1016657970 6:146543446-146543468 CTCCCCGGAGGCCCACCAGCGGG + Intergenic
1017324579 6:153130965-153130987 CGCCGCGCAGCCGCCCCCGCCGG + Intronic
1019360610 7:602514-602536 CCTCCAGCAGTCCCAGCCGCCGG + Intronic
1019475257 7:1241341-1241363 CGCCCCGGAGTCGCAGCGGCGGG - Intergenic
1019718669 7:2555090-2555112 CGCCCCCCTCTCCCCCCCGCCGG - Intronic
1023964548 7:44956157-44956179 CTCCCTGCAATCCCACCAGCAGG + Intergenic
1025092974 7:56078345-56078367 AGCCCTGCAGCCCCACCGGCGGG - Intronic
1028121413 7:87059700-87059722 CGCCCCGCGGTCCCTCCCTCCGG - Intergenic
1029068042 7:97872176-97872198 CGCCCCGCCCTCCCTACCGCAGG + Intronic
1029423730 7:100484339-100484361 CGCCCCTCAATCCCACCCGGGGG - Intronic
1032085869 7:128883756-128883778 CGCCCTGCAGCGCCACCTGCTGG + Intronic
1034425876 7:151013714-151013736 CGCCCCGCAGACCTACGTGCAGG + Exonic
1034557607 7:151859995-151860017 CAGCCCACAGTCCCACCTGCAGG - Intronic
1035153187 7:156892584-156892606 CGCACCGCAGCCCTCCCCGCGGG + Intronic
1036789918 8:11710361-11710383 CGCCCCGCACTCCCGCCTGCGGG - Intronic
1042859071 8:73295127-73295149 CGCCGCGCACTCCAACCCGGCGG + Exonic
1047292173 8:123540754-123540776 GGCCCCGTAGTCCCACCCTCCGG + Intronic
1047403037 8:124562005-124562027 TGCCCCACAGCCCCACCTGCTGG - Intronic
1048996836 8:139799783-139799805 GGCCCTGCAGTCCCACGGGCTGG + Intronic
1049769901 8:144374874-144374896 CCCCCCGCAGTCCTAACCGCAGG - Intronic
1049777641 8:144413913-144413935 CCCCCAGCACACCCACCCGCCGG + Intronic
1052997465 9:34558942-34558964 AGCCCAGCTGTCCCACCCTCAGG + Intronic
1055640429 9:78315159-78315181 AGCTCTGCAGTCCCACTCGCAGG + Intronic
1056962564 9:91139133-91139155 CGCCCCCCAGGCCCTCCAGCTGG + Intergenic
1057781798 9:98056585-98056607 CGCCCCGCCGCCCTTCCCGCGGG + Intergenic
1058869804 9:109191945-109191967 CGCCCTGCATGCCCACCCGTGGG - Intronic
1060970512 9:127734991-127735013 CGCCCCTCGGTCCCACCCTCTGG + Intronic
1061783292 9:133008191-133008213 TGCCCCGCAGTCCCCTCCCCTGG - Intergenic
1062041734 9:134407531-134407553 CACCCCTCCGCCCCACCCGCCGG - Intronic
1062364725 9:136203212-136203234 CGCCCCGCGGCCCCGCCCCCCGG - Intronic
1062565515 9:137162394-137162416 CGCCCCGCAGCCCCTTCGGCCGG + Exonic
1062601063 9:137318789-137318811 CGCCCAGGAGTCCCACCGCCTGG + Intronic
1188004100 X:25005545-25005567 CGCCCTTCACTCTCACCCGCAGG - Intronic
1190330206 X:49230989-49231011 CGCCCCCCGGTCCCACCCCCAGG - Exonic
1192143896 X:68667710-68667732 CTCCCCTCAGCCCCACCCCCAGG - Intronic
1197774614 X:130110980-130111002 CCGCCCGCAGTCCCTCCCGTCGG - Intergenic
1198205327 X:134460105-134460127 CGCCCCGCAGGCCCCGCCCCCGG - Intergenic