ID: 1179512583

View in Genome Browser
Species Human (GRCh38)
Location 21:41883719-41883741
Sequence GAGTCACGCCCTGCTGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179512583_1179512588 15 Left 1179512583 21:41883719-41883741 CCTGTTACAGCAGGGCGTGACTC No data
Right 1179512588 21:41883757-41883779 GACAGTCACAGTGTGGAGCTGGG No data
1179512583_1179512589 16 Left 1179512583 21:41883719-41883741 CCTGTTACAGCAGGGCGTGACTC No data
Right 1179512589 21:41883758-41883780 ACAGTCACAGTGTGGAGCTGGGG No data
1179512583_1179512584 -7 Left 1179512583 21:41883719-41883741 CCTGTTACAGCAGGGCGTGACTC No data
Right 1179512584 21:41883735-41883757 GTGACTCGCAGTTTCCACTGTGG No data
1179512583_1179512592 30 Left 1179512583 21:41883719-41883741 CCTGTTACAGCAGGGCGTGACTC No data
Right 1179512592 21:41883772-41883794 GAGCTGGGGAAGGCCAGTGGAGG No data
1179512583_1179512591 27 Left 1179512583 21:41883719-41883741 CCTGTTACAGCAGGGCGTGACTC No data
Right 1179512591 21:41883769-41883791 GTGGAGCTGGGGAAGGCCAGTGG No data
1179512583_1179512586 8 Left 1179512583 21:41883719-41883741 CCTGTTACAGCAGGGCGTGACTC No data
Right 1179512586 21:41883750-41883772 CACTGTGGACAGTCACAGTGTGG No data
1179512583_1179512587 14 Left 1179512583 21:41883719-41883741 CCTGTTACAGCAGGGCGTGACTC No data
Right 1179512587 21:41883756-41883778 GGACAGTCACAGTGTGGAGCTGG No data
1179512583_1179512590 20 Left 1179512583 21:41883719-41883741 CCTGTTACAGCAGGGCGTGACTC No data
Right 1179512590 21:41883762-41883784 TCACAGTGTGGAGCTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179512583 Original CRISPR GAGTCACGCCCTGCTGTAAC AGG (reversed) Intergenic
No off target data available for this crispr