ID: 1179514625

View in Genome Browser
Species Human (GRCh38)
Location 21:41898167-41898189
Sequence CTGGCTCTGGCTCTTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179514625_1179514632 14 Left 1179514625 21:41898167-41898189 CCCCACACAAGAGCCAGAGCCAG 0: 1
1: 1
2: 3
3: 27
4: 343
Right 1179514632 21:41898204-41898226 CTTCACCTGAGCTCACGGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 111
1179514625_1179514631 9 Left 1179514625 21:41898167-41898189 CCCCACACAAGAGCCAGAGCCAG 0: 1
1: 1
2: 3
3: 27
4: 343
Right 1179514631 21:41898199-41898221 CTGAGCTTCACCTGAGCTCACGG 0: 1
1: 0
2: 4
3: 25
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179514625 Original CRISPR CTGGCTCTGGCTCTTGTGTG GGG (reversed) Intronic
900021388 1:188469-188491 CTTGCTCTGGATCCTGTGCGGGG + Intergenic
901063578 1:6484922-6484944 CTGGCCCCAGCCCTTGTGTGAGG - Intronic
901162689 1:7192149-7192171 CTGGTTCTGGCTCTTCTGGTTGG + Intronic
902818140 1:18927633-18927655 TTGGCCCTGGCTCTGCTGTGAGG - Intronic
903557842 1:24206320-24206342 CTGGCTCTGGGTCTCCCGTGGGG + Intergenic
903973923 1:27137122-27137144 CTGGCACTGACACTTGTGTGTGG - Intronic
905182981 1:36178061-36178083 CTTGCTCTGGCTCTTGTCCTCGG - Exonic
905710370 1:40097202-40097224 CTGCCTGTGGCTCTTGGCTGTGG - Exonic
905810916 1:40912525-40912547 ATGGCTCTGGCTCTCCAGTGTGG - Intergenic
906243032 1:44253878-44253900 CTGGCTCAGGATCTCTTGTGTGG - Intronic
907472491 1:54682931-54682953 CTGGCTCTGGCTCTTGTCTGTGG + Intronic
907720710 1:56969457-56969479 CTGTCTCTAGCTCTTGAATGTGG - Intergenic
907818617 1:57944875-57944897 CTTGCTCTGCTTCCTGTGTGAGG - Intronic
909012119 1:70346765-70346787 CTCACTCGGGCTGTTGTGTGAGG - Intronic
911172120 1:94781123-94781145 CTGGCTCTGGGTCTCTTGTTTGG - Intergenic
913722118 1:121607322-121607344 ATAGTTCTGGCTCTTGTGTCAGG + Intergenic
913741903 1:121854902-121854924 ATAGTTCTGGCTCTTGTGTCAGG + Intergenic
915002924 1:152609866-152609888 CTGTCTCTGCTTCTTCTGTGTGG + Intergenic
916190191 1:162170824-162170846 CTGCCTCAGCCTCTTGAGTGTGG - Intronic
916488985 1:165284892-165284914 CTGGCTGTGGCTCTTGGTTCTGG - Intronic
918467754 1:184838762-184838784 CTGCCTCTGGCTGTGGTGTTGGG + Intronic
920034072 1:203054402-203054424 CTGGCTCTGTCACTTCTGTGTGG - Intronic
920200482 1:204257137-204257159 ATGGCTTTGCCTCTTGAGTGGGG - Intronic
921465440 1:215481575-215481597 ATGGCTCAGGCTTTTGTTTGTGG - Intergenic
922218313 1:223538917-223538939 CTAGCTCTGGCTCTGGGATGTGG - Intronic
922583180 1:226713524-226713546 CTGGCCCTGGCCCTGGGGTGAGG - Intronic
922599258 1:226837191-226837213 GTGGGCCTGGCTCCTGTGTGAGG - Intergenic
923469762 1:234280068-234280090 CTCTGTGTGGCTCTTGTGTGAGG - Intronic
924409103 1:243784737-243784759 CTGGCTGTGGCTACTGTGCGTGG - Intronic
1064014455 10:11761728-11761750 CTGGCTCTGGCTCTTGCTCTTGG - Intronic
1066192633 10:33069936-33069958 CTGGCTCTGGCATTTTTATGAGG + Intergenic
1066986659 10:42474698-42474720 TTGGTTCTGATTCTTGTGTGCGG - Intergenic
1067756723 10:49011238-49011260 CATGCCCTGGCTCTTGTCTGTGG - Intergenic
1067818959 10:49509942-49509964 CTGAATCTGGCAGTTGTGTGAGG - Intronic
1070615702 10:77967870-77967892 TTGGCTCTGGCTCTTGTGTTTGG + Intergenic
1071073219 10:81719402-81719424 CTGGCCCTGGATGTTTTGTGTGG - Intergenic
1072720039 10:97774757-97774779 TTGGTTCTGGCTCTGGTTTGGGG + Intergenic
1073033438 10:100546615-100546637 ATGGAACTGGCTCTTGGGTGAGG + Intronic
1074272227 10:111965380-111965402 CTGGCTCTGGCTCTTTGGAGTGG - Intergenic
1074288042 10:112116670-112116692 CTGTCTTTGGCTTTAGTGTGAGG - Intergenic
1075457304 10:122593151-122593173 CTTGCCCTGGGTCTGGTGTGGGG + Intronic
1075458886 10:122602681-122602703 CTTGCCCTGGGTCTGGTGTGGGG + Intronic
1075459517 10:122606740-122606762 CTTGCCCTGGGTCTGGTGTGGGG + Intronic
1075460149 10:122610799-122610821 CTTGCCCTGGGTCTGGTGTGGGG + Intronic
1075460781 10:122614858-122614880 CTTGCCCTGGGTCTGGTGTGGGG + Intronic
1076550884 10:131277599-131277621 CTGGCTCAGGTTCTCGTCTGGGG + Intronic
1076563108 10:131380509-131380531 CTGTCTGTGGCTCTCGTCTGAGG + Intergenic
1076672642 10:132131560-132131582 CAGCCTCTGACTCTTGTTTGTGG + Intronic
1076833081 10:133006737-133006759 CCGTCTCTCGCTCTTGGGTGTGG - Intergenic
1076899272 10:133329109-133329131 CTGTCCCTGGCTCTGGTGTGAGG - Intronic
1077165168 11:1131504-1131526 CTGGCTCTGCCTCTTGTCTTGGG - Intergenic
1077208803 11:1358508-1358530 CTGGCTATGGCTCTCCAGTGAGG + Intergenic
1078576523 11:12507544-12507566 CTGCCTCTGCCTCTTGGCTGGGG + Intronic
1079206900 11:18423550-18423572 CTGGCTTTGATTTTTGTGTGTGG - Intronic
1081462990 11:43288988-43289010 CTGCCTCCAGCTCCTGTGTGTGG - Intergenic
1081731258 11:45373324-45373346 CTGTCACTGGTTCTTGTGTGTGG + Intergenic
1083294220 11:61706609-61706631 CTGTCTCTGGATGTTGTGGGAGG - Intronic
1084183606 11:67458693-67458715 CTGGGTCTGGCTGGTGTCTGGGG - Exonic
1085240631 11:75051071-75051093 CTTGCTGTGGCTCCTGTGTCAGG + Intergenic
1085310694 11:75515003-75515025 CTGGCTCTGCCTCTCTTGAGTGG - Intronic
1085735901 11:79038829-79038851 CTGGCTCTTTCTCTTCTATGAGG - Intronic
1085803292 11:79611499-79611521 CTCCCTCTGGCTCTTGGGAGGGG + Intergenic
1087094854 11:94308354-94308376 CTGGCTTTGGGTCCTTTGTGTGG - Intergenic
1089174293 11:116537231-116537253 CTTGCTCTGGCTTTGGGGTGGGG + Intergenic
1089292107 11:117443662-117443684 CTGCCTCCGGCTCTTGCCTGGGG - Intronic
1091789767 12:3265060-3265082 CTGTCTCACGATCTTGTGTGTGG + Intronic
1092076775 12:5680533-5680555 CTGGCTCTGCCTCCTCTGTGTGG + Intronic
1092575768 12:9781513-9781535 CTGGCTCTTTCTCATCTGTGTGG + Intergenic
1093302562 12:17473864-17473886 GTGGGCCTGGCTCCTGTGTGGGG - Intergenic
1093460744 12:19404702-19404724 TTGGGTCTGGCTCGTGGGTGTGG + Intronic
1093798342 12:23340755-23340777 GTGGCTCTGGCATTTGAGTGAGG + Intergenic
1095239114 12:39836059-39836081 CTTTCTCTGGCTTTTCTGTGTGG - Intronic
1095507898 12:42917504-42917526 CTGGCTCTGTCTCTGGTGTAGGG - Intergenic
1096511661 12:52133319-52133341 CTAGCTCTGGGTCTTTTATGAGG - Intergenic
1099031536 12:77531192-77531214 CTGGCTCTGGCTGCTGTGTATGG + Intergenic
1099533668 12:83819102-83819124 CTGGTGCTGGCTTTTGTCTGGGG + Intergenic
1099961740 12:89403503-89403525 CAGGCTCTGACTCTTCTCTGAGG - Intergenic
1101769989 12:107740617-107740639 CTGGCTCTGGCTGGTGACTGGGG + Intronic
1101814057 12:108131597-108131619 CTGCTTTTGGGTCTTGTGTGGGG + Intronic
1102819025 12:115892310-115892332 TTGGTTCTGGCTCTTGGCTGGGG - Intergenic
1104904955 12:132208226-132208248 GTGCCTCTGGCTCCTGTGGGAGG - Intronic
1104906312 12:132215320-132215342 CTGACTGTGTCTCGTGTGTGGGG - Intronic
1108495460 13:51020274-51020296 CTGGCTCTGTCACTTGTAAGTGG - Intergenic
1113521721 13:110946424-110946446 CTGCCTTTGGCTCTCCTGTGGGG + Intergenic
1113695459 13:112342775-112342797 CAGGCACTGGCTCATGTCTGGGG + Intergenic
1114320052 14:21539761-21539783 CTAGCTCTGGCTCTCGTATATGG - Intergenic
1114558109 14:23573380-23573402 CTGCCTCTGGCCCTTCAGTGGGG + Intronic
1116336813 14:43666759-43666781 CTGGTTCTTGCTCATGTTTGTGG - Intergenic
1117966396 14:61210979-61211001 CTGTCTCTGCATCTTGTGTTGGG + Intronic
1119422178 14:74513913-74513935 CTGGCTGGGGCTCTGGTCTGAGG - Intronic
1119642924 14:76328443-76328465 CTGCCTGCGGCACTTGTGTGTGG - Intronic
1120534585 14:85678369-85678391 GTGGCCCTGGATCTTGTGAGTGG - Intergenic
1121235556 14:92389249-92389271 CTGAATCTACCTCTTGTGTGTGG + Intronic
1122249860 14:100430217-100430239 CTGGCTCTGGCTGGTATGTTGGG + Intronic
1122960240 14:105090855-105090877 CCGGCCCTGGCTCTTGGGAGTGG + Intergenic
1124093727 15:26629439-26629461 CTGGCACTGGCTCTTGGCTGTGG + Intronic
1124430472 15:29603421-29603443 CTGCCTCTTGCTCAAGTGTGAGG + Intergenic
1125349897 15:38755592-38755614 TTAGCTCTGGCTCATGGGTGTGG - Intergenic
1125522268 15:40354852-40354874 CTGCCTATGGCTCTTTTGTTTGG - Intronic
1125608486 15:40955754-40955776 CAGGCTCTGGCGCTGGTGTGAGG + Exonic
1126205796 15:46043239-46043261 CTGGCTCTGGATTTTCTATGAGG - Intergenic
1126358317 15:47819416-47819438 CTGGCTCAGGATCTCTTGTGAGG - Intergenic
1126563542 15:50071135-50071157 GTGGCTGTGGCTCTTCTGTTGGG - Intronic
1127582908 15:60353952-60353974 CTGGCTCAGGGTCTTTTCTGAGG - Intronic
1129980404 15:79864055-79864077 CTGGCTCTGCCTTTTGACTGTGG + Intronic
1130535854 15:84784465-84784487 CTGGCTCAGGCTCTTCTCTAAGG - Exonic
1132331029 15:101012722-101012744 CTGGTGCAGCCTCTTGTGTGCGG + Intronic
1132747418 16:1442836-1442858 CTGGCTCCGGAGCTTGCGTGGGG - Intronic
1133140413 16:3739724-3739746 CCGGCTCTGGCTTTTGTTTCAGG - Exonic
1133161864 16:3917224-3917246 CTGGCTCGGGGTCTCTTGTGAGG - Intergenic
1133205878 16:4233216-4233238 CTAGCTCTGGCTAGAGTGTGGGG - Intronic
1134878578 16:17724511-17724533 CTAGCCCTGCCTCTTGTGTTTGG + Intergenic
1137284292 16:47002414-47002436 CTAGCTATGGCTGTTGTTTGGGG + Intergenic
1138597586 16:58037277-58037299 TTTGTTCTGGCTCTTATGTGAGG + Intronic
1139956833 16:70697243-70697265 CAGGTTCTGGCTCTCCTGTGGGG + Exonic
1140032689 16:71351034-71351056 CTCCCTCTGGCTCCTGTGTAGGG - Intergenic
1140415801 16:74773483-74773505 CTGGCTCTGGGACTGGTATGGGG - Intronic
1141193993 16:81845904-81845926 CTGGCTCTTGCACTTGTGGCTGG + Intronic
1141403356 16:83770304-83770326 GTGGCTCTGGCTCTTATGGACGG + Intronic
1141656322 16:85418564-85418586 CTGGGTCTGGCTCCTGGGAGGGG - Intergenic
1141713827 16:85715822-85715844 CTGGCTGTGGCTTTTGTTTTTGG - Intronic
1142032891 16:87847211-87847233 CTGTCTGTGGCTCTGGGGTGTGG - Intronic
1142106480 16:88306337-88306359 CTGCCTCTGCCTCCTGTGTGAGG + Intergenic
1142868270 17:2804461-2804483 CTGGGTCTGTGTTTTGTGTGTGG + Intronic
1143256759 17:5563162-5563184 CTGGTTCTTTCTCGTGTGTGTGG - Intronic
1143538080 17:7553503-7553525 CTGTGTCTGGCACTTGTGTTTGG + Intronic
1144654922 17:17029329-17029351 CTGGCTCTGGGTCTGGGGGGTGG - Intergenic
1145054588 17:19692700-19692722 CTTGATCTGGCTTTTGTGTAAGG - Intronic
1145876911 17:28325812-28325834 GTGGCTCAGGCTCATGTCTGTGG + Intronic
1146372931 17:32276478-32276500 TGGGCTCTGGCTGTTGGGTGGGG + Intronic
1146670617 17:34734954-34734976 CTGGCTCTGGGTCTTTTCTTTGG - Intergenic
1147648052 17:42045750-42045772 CTGTCTCTGGCTGTTGGGTGAGG - Intronic
1148220876 17:45860928-45860950 CTGGCTCTGGCTGTAGTATGGGG - Intergenic
1148676347 17:49447774-49447796 CTGGGTCTGGTTCTAGTGTTGGG + Intronic
1148793551 17:50186734-50186756 CTGGCTCAGGCTCTTGAGGGTGG + Exonic
1148834677 17:50459814-50459836 CTGGCTCGGGTTCTAGTCTGGGG - Intronic
1149130487 17:53295292-53295314 GTGGCTCTGGCTCTGGTAGGTGG - Intergenic
1149319860 17:55471774-55471796 ATGGGCCTGGCTCCTGTGTGAGG - Intergenic
1151376082 17:73690069-73690091 CTGGCTCTGGGTCTCCTGTTTGG + Intergenic
1151493777 17:74447369-74447391 CTGGATCTTGCTCCTCTGTGAGG + Exonic
1151625317 17:75272201-75272223 CTGGCCCTGGCCCTGGCGTGTGG - Intergenic
1152334256 17:79691486-79691508 CTGGCTCTGCCTCCGTTGTGGGG - Intergenic
1152360678 17:79831864-79831886 CTAGCCCTGGCTTTTGTGAGTGG - Intergenic
1152421658 17:80196606-80196628 CTGGCCCTGGCTCTGCTGTGTGG + Intronic
1152575192 17:81136781-81136803 CTGGCTCTGGCTGGCTTGTGTGG - Intronic
1152882042 17:82823182-82823204 CTGGCTCAGGCTCTTGTGGGGGG + Intronic
1153115648 18:1652519-1652541 ATGACTCTGGTTCTTGAGTGTGG + Intergenic
1156229560 18:35140300-35140322 CTGCTTCCGGCTCTTCTGTGTGG - Exonic
1157389674 18:47291053-47291075 ATAGCTCTGGCTGCTGTGTGGGG - Intergenic
1157580855 18:48773471-48773493 CTGGCTCTGGCTGGTGGGGGTGG - Intronic
1159136921 18:64347543-64347565 GTGCCTCAGGCTCTTATGTGTGG + Intergenic
1161603970 19:5204276-5204298 CTATCTCTGGCTCCTGTGGGTGG + Intronic
1161872272 19:6879313-6879335 CTGGCTCAAGCTCTTGCTTGAGG + Intergenic
1162495339 19:11020177-11020199 CTGGTTCGGGCTGTTCTGTGAGG + Intronic
1162783860 19:13022158-13022180 CCGGGTCTGGCTGTTGTTTGTGG + Intronic
1162919015 19:13889579-13889601 CTGGCTCTGGCACCTGGGAGCGG - Exonic
1163055203 19:14712740-14712762 CTGTCTCTGTCTCTTCTGTTAGG + Intronic
1163586966 19:18169404-18169426 CCGGCTCTGGCTCTTGTTTGGGG + Exonic
1164259026 19:23553176-23553198 ATGGGCCTGGCTCCTGTGTGAGG - Intronic
1164938537 19:32233271-32233293 TTGGCGGTGGCCCTTGTGTGAGG - Intergenic
1166140884 19:40804536-40804558 GGGGCTCTGGCTGCTGTGTGGGG + Intronic
1166361245 19:42253842-42253864 GCGGCTCGGGCTCCTGTGTGCGG - Intronic
1166678920 19:44755948-44755970 GTCCCTCTGGCTGTTGTGTGGGG + Intronic
1167347439 19:48955246-48955268 CTGCCTCTGGCACTGGTGGGAGG + Intronic
1167399899 19:49258153-49258175 CTGGCCCTAGCTCATGTGTAAGG + Intergenic
925309868 2:2874948-2874970 CTGGCTCTGGCTCTGGGCGGAGG - Intergenic
927222475 2:20726168-20726190 CAGGCTCTGGTACTTGAGTGGGG + Intronic
928064943 2:28154024-28154046 CTGCTTCTGCCTATTGTGTGTGG + Intronic
928266966 2:29820380-29820402 CTGGCTCAGGGTCTTTTCTGAGG - Intronic
929109459 2:38394289-38394311 CTGGCTATGACTCTTGAGTTAGG - Intergenic
929820081 2:45266200-45266222 CTGGCTCTGGCTTTTAGATGTGG - Intergenic
929877265 2:45807103-45807125 CTGGCTCTGCCTTTTGTTAGAGG + Intronic
931230582 2:60371466-60371488 GTGGCTGTGGGTCTTGGGTGTGG - Intergenic
933123335 2:78571117-78571139 CTGGCTCAGGGTCTTTTATGAGG + Intergenic
934141572 2:89052284-89052306 ATGGGCCTGGCTCCTGTGTGAGG - Intergenic
934227671 2:90148259-90148281 GTGGGCCTGGCTCCTGTGTGAGG + Intergenic
935194538 2:100804656-100804678 CTGGAACTGGCTCTTGTGGCAGG - Intergenic
935270797 2:101432735-101432757 CCAGCTCTGGATGTTGTGTGTGG - Intronic
935313347 2:101806950-101806972 CTGGCCCTGGCGATTCTGTGTGG + Intronic
936503294 2:113083621-113083643 GTGTCTCTGTCTCTTGTGTTAGG - Intergenic
938115517 2:128600697-128600719 CTGGCTCTAGGGCTTGTGTGAGG + Intergenic
938974560 2:136463386-136463408 CAGGCTGAGGCTCTTGTGTAGGG - Intergenic
939522452 2:143247439-143247461 CTGGCTCTGGGTCTCGTCTTTGG + Intronic
942015785 2:171813415-171813437 GTGGCTCTGGCTCTGTTGTTGGG - Exonic
942472946 2:176281495-176281517 CTAGCTCAGGCACTTGTATGTGG - Intronic
944881348 2:204016209-204016231 CTGGGTCTGGCTCATATGTGAGG + Intergenic
945936868 2:215911428-215911450 ATGAGACTGGCTCTTGTGTGAGG - Intergenic
946011625 2:216569221-216569243 CTCACTCTGGCTGTTGTCTGGGG + Intronic
946162780 2:217846333-217846355 CTGGCTCAGGACCTGGTGTGGGG - Intronic
946612488 2:221474264-221474286 ATGGCGCAGCCTCTTGTGTGTGG - Intronic
947013660 2:225593337-225593359 CTGGCTTGGCTTCTTGTGTGGGG + Intronic
948426070 2:237887146-237887168 CTGGCTGTGGGTCCTGTGTGGGG + Intronic
948670337 2:239564421-239564443 CTGACCCTGGCACCTGTGTGAGG - Intergenic
948861385 2:240754330-240754352 CTGGCTGTGGCTCTAGTGCTGGG + Intronic
1170295474 20:14819951-14819973 ATTCCTCTGGCTCTGGTGTGTGG + Intronic
1170412541 20:16106890-16106912 CTGGCTCTTCCACCTGTGTGTGG - Intergenic
1170589209 20:17758446-17758468 ATGGCCCTGGCTGATGTGTGGGG + Intergenic
1170595403 20:17801750-17801772 CTGGGTCTGGGTCTTTTTTGCGG + Intergenic
1171132095 20:22663411-22663433 CTGCCTCTGGCTTTGGTGTTGGG + Intergenic
1171243413 20:23589234-23589256 CTAGCTCTGTGTCTTGTGTCTGG + Intergenic
1171251571 20:23653082-23653104 CTGGGCCTGGGTCGTGTGTGGGG - Intergenic
1172240719 20:33410976-33410998 CTGGCTCTGGCCCGTGTGTCAGG - Intronic
1172298696 20:33832432-33832454 CTGGCACTGGCGCTTTGGTGTGG - Intronic
1173059867 20:39650938-39650960 CTGGCTCTGCCCCCTGTGTCTGG + Intergenic
1173059875 20:39650973-39650995 CTGGCTCTGCCCCCTGTGTCTGG + Intergenic
1173343717 20:42178656-42178678 CTGGCTCAAGGTCTTTTGTGAGG + Intronic
1173622606 20:44448266-44448288 ATGCCTCTGGCTCCTGTGTACGG + Intergenic
1174361270 20:50030186-50030208 GGGGCTCTGGCTCCTGTCTGGGG - Intergenic
1174893237 20:54420699-54420721 ATGACTCTGGCTTCTGTGTGAGG + Intergenic
1175790631 20:61738018-61738040 ATGCCTGTGGCTCTGGTGTGAGG + Intronic
1175895436 20:62333798-62333820 CTTCCTCTGGCTCATGTGGGTGG - Intronic
1178229286 21:30762811-30762833 CTGGCTCTGGCTGTGGTGATGGG - Intergenic
1178476970 21:32945358-32945380 CAGGCTCTGGCTCTGGGGGGAGG + Intergenic
1178731757 21:35110193-35110215 CTGATTCTGGCTCTTATTTGAGG - Intronic
1179514625 21:41898167-41898189 CTGGCTCTGGCTCTTGTGTGGGG - Intronic
1179806985 21:43845619-43845641 CTGGCTCAGGGTCTCTTGTGAGG - Intergenic
1180189043 21:46154003-46154025 CTGGCTCTGGCTCTCCTAGGAGG - Intronic
1180987493 22:19913432-19913454 CTGACTCTGACTCTTCTTTGTGG - Intronic
1181339221 22:22165172-22165194 CTGGCTCTGTGTCCTGGGTGTGG + Intergenic
1182419600 22:30242465-30242487 CTGGCCCTGGCGCTTGTGTCGGG + Exonic
1182434355 22:30320899-30320921 CAGATTCTGGCGCTTGTGTGAGG + Intronic
1182512173 22:30827247-30827269 CTGGCTCTGGAGGTGGTGTGTGG + Intronic
1182558864 22:31143398-31143420 CTGGCCCTGGCCCTTTTCTGTGG - Intergenic
1183167032 22:36155782-36155804 CTGGCTCGGAATCTTGTCTGGGG + Intronic
1184310799 22:43641206-43641228 CAGGCTCTTGCTATTGTGTCTGG + Intronic
1184873011 22:47252751-47252773 TTGGCTGTGGCTCTGTTGTGAGG - Intergenic
949165758 3:938791-938813 CTGGCTCTTTCTCATCTGTGTGG - Intergenic
949582962 3:5409525-5409547 TTCACTCTGGCTCTTGGGTGTGG + Intergenic
950609634 3:14117666-14117688 CTGGCTCTGTCTGTTCTCTGGGG - Intronic
950624616 3:14235767-14235789 CTGATTCTGGCTGCTGTGTGGGG + Intergenic
950807964 3:15624712-15624734 CTGACTCTGGTTCTTCTGGGAGG + Intronic
950876510 3:16279596-16279618 CTGGCTCTTGCTCTTCTGCTTGG - Intronic
952946119 3:38478808-38478830 CTGGCTCTGCCTCATTTGTTGGG + Intronic
953129934 3:40128147-40128169 CTGGCTCTGGGTCTTTTCTTTGG - Intronic
954672170 3:52297053-52297075 CTGGGTCTGGGTCATGTGCGAGG + Intergenic
955009717 3:55002290-55002312 CTGGCTCTGGCACATGTTTTAGG + Intronic
955651006 3:61193809-61193831 TTGGCTGTGACTCTTGTGAGAGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956459189 3:69454470-69454492 CTGGCGCTGGCCCGTGAGTGTGG - Intronic
956765150 3:72478558-72478580 CTGATTCTGCCTCTTGAGTGGGG + Intergenic
957265246 3:77955250-77955272 ATGGCTCTGTCTTTTGTGTTTGG - Intergenic
958906036 3:99943237-99943259 ATGGGACTGGCTTTTGTGTGTGG + Intronic
961446649 3:126984241-126984263 CTGCCCCAGGCTCCTGTGTGGGG + Intergenic
961641367 3:128366636-128366658 CAAGCACTGACTCTTGTGTGTGG + Intronic
962043023 3:131726883-131726905 CTATCTCATGCTCTTGTGTGAGG + Intronic
963657736 3:148079500-148079522 CTGCCTCTGGCTCTCTTGTGTGG - Intergenic
964816273 3:160720338-160720360 CTAGCTGTGGCTCTTGCATGAGG + Intergenic
965685293 3:171295834-171295856 CTGGCACTCTCTCTTGGGTGAGG - Intronic
968515949 4:1015708-1015730 CGGGCTGTTGCCCTTGTGTGTGG + Intronic
968850971 4:3077988-3078010 ATGGCTCTTGCTCTTTGGTGTGG + Intronic
969054161 4:4391128-4391150 CAGGCTTTGGCTCTGGTGGGTGG + Intronic
969407403 4:7002941-7002963 AGGTCTCTGGCTCGTGTGTGTGG + Intronic
969480650 4:7445281-7445303 CAGGCTCTGGCTGGTGTTTGAGG + Intronic
969545369 4:7823085-7823107 CCTGCTCTGGCCCTTCTGTGTGG + Intronic
971044510 4:22790731-22790753 CTGGCTGTCACTCTTCTGTGTGG + Intergenic
973721671 4:53730530-53730552 CTGGCATTGGCTCATGTGTTTGG + Intronic
976206501 4:82627543-82627565 CAGTCTCTGGCTTGTGTGTGGGG + Intergenic
977893145 4:102335058-102335080 CTGGCTCTGTCTCTAGTCTTGGG - Intronic
978853613 4:113367963-113367985 TTAGCTCTGGCACTTGTGTTTGG - Intronic
979787757 4:124737997-124738019 CTGGCTCTGCCTCTTGGGACTGG - Intergenic
980093072 4:128462400-128462422 CTGGCTCTGGCTCTCTTGACTGG - Intergenic
981356800 4:143798763-143798785 CTGGGTTTGGGACTTGTGTGGGG - Intergenic
981627531 4:146776376-146776398 CTGGTTCTGTCTCATCTGTGTGG + Intronic
982138624 4:152296305-152296327 CTGCCCCTGGCACTTGGGTGAGG - Intergenic
982467768 4:155751393-155751415 CTGGCTTTGGTTCCTGTCTGTGG + Intergenic
983056374 4:163102720-163102742 CGTGGTCTGGCTCTTGTGTAAGG + Intergenic
986220597 5:5765540-5765562 CTGGCACTGGCTGGTGTTTGAGG + Intergenic
987582899 5:19819772-19819794 GTGGCTCTGGCTCCTGTGAATGG + Intronic
988194563 5:27986524-27986546 CTGGCTCTGGGTGTTATGAGGGG - Intergenic
994558239 5:101331576-101331598 CTGGTTCTTTCTCATGTGTGTGG - Intergenic
994644301 5:102450232-102450254 CTGGTTCTTACTCATGTGTGTGG + Intronic
996458932 5:123719018-123719040 GTGGCTGTTGTTCTTGTGTGAGG - Intergenic
997276532 5:132597504-132597526 CTCCCTCTGTCTCTTGTCTGAGG + Intronic
997393425 5:133535430-133535452 ATGGCTCAGGCTTTTGTTTGTGG - Intronic
997825810 5:137106121-137106143 CTGGCTCTGGTTGTGGTGGGGGG - Intronic
999834399 5:155353315-155353337 CTGGTTCTGTCTCATTTGTGTGG - Intergenic
999996247 5:157095323-157095345 CTGGCTCTGGCTCTTATCTTCGG - Exonic
1001023720 5:168205849-168205871 ATGACTCTGGCTATTGTGTATGG + Intronic
1001580200 5:172792932-172792954 CTGGCTCTGCCTGTGGTTTGTGG + Intergenic
1001886275 5:175293392-175293414 CTGGCTCAGGCTCCAGTGGGAGG - Intergenic
1001954431 5:175838608-175838630 CTGGCTCTGAGGCTTGGGTGAGG - Intronic
1002445440 5:179287506-179287528 CTGGCTAAGGCTCCCGTGTGGGG + Intronic
1002607395 5:180391293-180391315 CTGGCTCTGCCTCCCGTGGGCGG - Intergenic
1003565252 6:7216878-7216900 CTTGCTCTGGGCCTTGGGTGGGG - Intronic
1006614602 6:35317964-35317986 CTGGCGCTGGCGCGTGTCTGAGG - Exonic
1006842534 6:37038960-37038982 CTGGCTGTGGCTCTGGTTTGGGG - Intergenic
1007366286 6:41396411-41396433 CTCTCTCTGGCCATTGTGTGTGG - Intergenic
1007720216 6:43880553-43880575 CTGACTCTGCCTCTTATCTGAGG + Intergenic
1011057338 6:83219353-83219375 AAGGCTCAGGCTCTGGTGTGAGG + Intronic
1011581598 6:88872860-88872882 CTGGGTCTGGATCTTCTTTGGGG - Intronic
1012332816 6:98014931-98014953 CTGGCCATGGCTATTGTGTCTGG - Intergenic
1012963478 6:105647489-105647511 CTGGCTCTGCCATTTGTGAGTGG - Intergenic
1014122470 6:117740791-117740813 GTAGCTTTGGGTCTTGTGTGGGG - Intergenic
1014963266 6:127713877-127713899 CTTACTCTGGCTGTTGTGTTGGG + Intronic
1017762680 6:157583320-157583342 CTGGCTCTTTCTCATCTGTGTGG + Intronic
1019094705 6:169569905-169569927 ATGGCTCTGGGTTTTGTGAGAGG - Intronic
1019193821 6:170269555-170269577 CTCACTTTGTCTCTTGTGTGGGG + Intergenic
1019278308 7:187597-187619 CTGTCTCTGCCTCCTGTGCGGGG + Intergenic
1020278604 7:6638479-6638501 CTGGCTTTGGAGCTTTTGTGAGG + Intronic
1020360087 7:7318948-7318970 CTCACTCTGGCTGTAGTGTGAGG + Intergenic
1021548452 7:21842961-21842983 GTGGCTCTGGATCTTGTTTGAGG + Intronic
1022217832 7:28281722-28281744 CTGGCTCTGGGTCTCTTGTTCGG + Intergenic
1022362650 7:29677305-29677327 ATTACTCTGGCTATTGTGTGAGG - Intergenic
1022428614 7:30292957-30292979 ATTACTCTGGCTATTGTGTGAGG + Intronic
1022430181 7:30311151-30311173 CTGGCTCTGGGTCTTGTTTTTGG + Intronic
1022698743 7:32736488-32736510 ATCACTCTGGCTATTGTGTGAGG + Intergenic
1024189300 7:46989277-46989299 ATTGCTCTGTCTGTTGTGTGAGG + Intergenic
1026023292 7:66727277-66727299 CTGGCCCTGGTTCTTGTCCGTGG + Intronic
1026268091 7:68812961-68812983 CTCGCTCATGCTCTTGTTTGTGG + Intergenic
1026541852 7:71286663-71286685 CTGGCTGTGAGTCTTGTGTTAGG + Intronic
1026681836 7:72472833-72472855 CAGGCTCTGTCCCTTGTGGGAGG - Intergenic
1027138403 7:75639918-75639940 CTGGCTGTGGCTCACGTGGGAGG - Intronic
1027267095 7:76500448-76500470 CTGGCTCTGGCTCTGGCTTCGGG - Exonic
1027318908 7:77000316-77000338 CTGGCTCTGGCTCTGGCTTCGGG - Intergenic
1027419389 7:78004913-78004935 CTGGCCCTGGCTCTTATTTTGGG - Intergenic
1028402979 7:90444792-90444814 CTGGTTATGGCTGTTATGTGAGG + Intronic
1029595188 7:101533926-101533948 CTGGCTTTGGCTTTTGCCTGTGG - Intronic
1030265331 7:107615238-107615260 CTGACTGTGGCTTTTCTGTGGGG - Intronic
1034655205 7:152723672-152723694 CTGGTTCTGGATTTTGTGGGGGG - Intergenic
1035006443 7:155665354-155665376 CTGGCGCTCTCTCTTGAGTGGGG + Intronic
1035241581 7:157534081-157534103 CTGGCTCTCGTTCCTGAGTGGGG + Intergenic
1036255434 8:7202630-7202652 CTGGCTCTGGCTCTGGCGCTGGG - Intergenic
1036362056 8:8084873-8084895 CTGGCTCTGGCTCTGGCGCTGGG + Intergenic
1036888912 8:12582157-12582179 CTGGCTCTGGCTCTGGCGCTGGG - Intergenic
1036896493 8:12640299-12640321 CTGGCTCTGGCTCTGGCGCTGGG - Intergenic
1037885925 8:22596326-22596348 CTGGCTCTTGTTCTTTGGTGTGG + Intronic
1039691330 8:39867889-39867911 ATGGCTCTGGCATCTGTGTGTGG + Intergenic
1039719678 8:40150029-40150051 ATGGCTCTGGGTGTTGTGTAGGG + Intergenic
1039905165 8:41781303-41781325 CTGGCTGTTGGGCTTGTGTGTGG - Intronic
1041625445 8:60020678-60020700 TTGTCTCTGGCTCTTGACTGAGG - Intergenic
1043425203 8:80141548-80141570 CTGGCTCTGGGTCTTCCATGAGG - Intronic
1045273685 8:100682796-100682818 CTGGCCCTGGCTCCAGTTTGGGG + Intergenic
1045500535 8:102741019-102741041 AGGGATCTGCCTCTTGTGTGTGG - Intergenic
1046283023 8:112058787-112058809 CTGACTCTGTCTCATATGTGTGG + Intergenic
1046419492 8:113961110-113961132 ATTGCTCTTTCTCTTGTGTGAGG + Intergenic
1047982552 8:130198013-130198035 CTGGCTCTGGGTCTTTTCTTCGG + Intronic
1048109757 8:131454619-131454641 CTGGTTCTTTCTCTTTTGTGTGG - Intergenic
1049315485 8:141964786-141964808 ACTGCTCTGGCTTTTGTGTGGGG + Intergenic
1049508702 8:143017390-143017412 CTGCCTCTGGGTCTTACGTGGGG - Intergenic
1049795869 8:144497020-144497042 CTGGGCCTGGTTATTGTGTGGGG + Exonic
1050074061 9:1845731-1845753 CTTGCTCTGTTTCATGTGTGGGG - Intergenic
1050660464 9:7878045-7878067 CTGCCTCTGTCTCTTGTCAGGGG - Intronic
1053122516 9:35557546-35557568 CTGGCACTGGCACTGGGGTGAGG + Intronic
1053548300 9:39046886-39046908 CTGGTTCTTTCTCTTCTGTGTGG - Intergenic
1053812420 9:41866939-41866961 CTGGTTCTTTCTCTTCTGTGTGG - Intergenic
1054618175 9:67320500-67320522 CTGGTTCTTTCTCTTCTGTGTGG + Intergenic
1055777635 9:79783063-79783085 CAAACTCTGGCTCTTCTGTGGGG - Intergenic
1055926671 9:81517410-81517432 CTTTTTCTGTCTCTTGTGTGAGG - Intergenic
1056091353 9:83208681-83208703 CTGGCTATCGGTCTTGTGGGCGG - Intergenic
1058577644 9:106420870-106420892 CTTGCTCTTGCTCATGTGAGGGG - Intergenic
1058874472 9:109231619-109231641 CTGGGTCTGAGTCCTGTGTGAGG + Intronic
1059343337 9:113612042-113612064 CTGGCTGTGGCTTGGGTGTGGGG + Intergenic
1060188452 9:121577790-121577812 CTGCCTCGGGCTGTTGTTTGAGG - Intronic
1060736411 9:126069130-126069152 CGGGCCCTGCCTCTTGGGTGTGG + Intergenic
1060770458 9:126327884-126327906 TGGGCTCTGGTTCTTGGGTGGGG - Intronic
1061506544 9:131034839-131034861 CTGTCTCTTGATCCTGTGTGTGG + Intronic
1061727967 9:132591423-132591445 CCAGCTCTGGCTCTGGTGGGGGG + Intergenic
1062238167 9:135522481-135522503 CTGGCTCTGACTCTGGTCGGGGG - Intronic
1062240411 9:135534579-135534601 CAGGCTCTGGTGCTTCTGTGAGG + Intergenic
1062302546 9:135883110-135883132 CTTCCTTTGGGTCTTGTGTGTGG - Intronic
1062474776 9:136721590-136721612 CTGCCTCTGGCCCTGGCGTGGGG + Intronic
1062573861 9:137197651-137197673 TTGGCCCTGGCTGCTGTGTGAGG - Intronic
1185469116 X:372024-372046 GGGGCCCTGGCTCTTCTGTGGGG - Intronic
1188267232 X:28092664-28092686 CAGGCTCTGGTTTTTGTTTGGGG + Intergenic
1189653235 X:43212099-43212121 CTGGCTCTTCCTCATCTGTGTGG - Intergenic
1190248037 X:48703532-48703554 CTGGCATTGTCTCTTGGGTGAGG - Intronic
1190282432 X:48939893-48939915 CTTGCTGTGGCTCTTCTGGGAGG - Intronic
1192080239 X:68040768-68040790 CTGCCCCTGGCTCTGGTGTGTGG + Intergenic
1192543270 X:71992936-71992958 CTGGCTGTAGCTGTAGTGTGTGG + Intergenic
1195991199 X:110684008-110684030 CTGGCTCTGGATCTTTTCTTCGG + Intronic
1196964226 X:121038264-121038286 CCAGCTAGGGCTCTTGTGTGCGG + Intergenic
1199407931 X:147484952-147484974 CTGGCTCTTTCTCATCTGTGTGG + Intergenic
1199975707 X:152893836-152893858 CAGGCTCTGCCTTTTGTCTGTGG - Intergenic
1200007541 X:153097780-153097802 GTGGGCCTGGCTCCTGTGTGAGG + Intergenic
1200360901 X:155604951-155604973 CTGGTTCTTTCTCCTGTGTGTGG - Intronic