ID: 1179516747

View in Genome Browser
Species Human (GRCh38)
Location 21:41913812-41913834
Sequence GATTCAGAACCACCCAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179516737_1179516747 16 Left 1179516737 21:41913773-41913795 CCCTGTCCCGAGTGACTCTGTGT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1179516747 21:41913812-41913834 GATTCAGAACCACCCAGAAGGGG 0: 1
1: 0
2: 2
3: 12
4: 157
1179516743_1179516747 9 Left 1179516743 21:41913780-41913802 CCGAGTGACTCTGTGTCTGGGGC 0: 1
1: 0
2: 3
3: 19
4: 242
Right 1179516747 21:41913812-41913834 GATTCAGAACCACCCAGAAGGGG 0: 1
1: 0
2: 2
3: 12
4: 157
1179516741_1179516747 10 Left 1179516741 21:41913779-41913801 CCCGAGTGACTCTGTGTCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 313
Right 1179516747 21:41913812-41913834 GATTCAGAACCACCCAGAAGGGG 0: 1
1: 0
2: 2
3: 12
4: 157
1179516738_1179516747 15 Left 1179516738 21:41913774-41913796 CCTGTCCCGAGTGACTCTGTGTC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1179516747 21:41913812-41913834 GATTCAGAACCACCCAGAAGGGG 0: 1
1: 0
2: 2
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179516747 Original CRISPR GATTCAGAACCACCCAGAAG GGG Intronic
900288163 1:1911672-1911694 GAAGCAGAACCAGACAGAAGGGG + Intergenic
900700686 1:4047012-4047034 GAATCAGAACCACCCAGCCCTGG - Intergenic
902279476 1:15363862-15363884 GATTCAGAAGCTCCCCCAAGAGG + Intronic
903360058 1:22771477-22771499 AACTTAGAACCACTCAGAAGGGG + Intronic
903734775 1:25523132-25523154 ACTTCATAACCACCCAGAGGCGG - Intergenic
906244762 1:44265125-44265147 AATTCAGAGGCCCCCAGAAGCGG + Intronic
907096984 1:51790914-51790936 GATTGAGAACCTCACTGAAGAGG - Exonic
916202480 1:162285139-162285161 GTCCCAGAAACACCCAGAAGAGG - Intronic
916600417 1:166287874-166287896 GAGTCAGAAGGACACAGAAGTGG - Intergenic
916890436 1:169107490-169107512 GAGTCATCACCACCCAGAAATGG + Intronic
917640256 1:176976695-176976717 GATGCAGAACCAGAGAGAAGTGG - Intronic
922678866 1:227573084-227573106 GATTCTGAACTACCCAGGTGCGG + Intronic
924095617 1:240547813-240547835 TGTTAAAAACCACCCAGAAGAGG + Intronic
924939014 1:248797510-248797532 GATTCATAATCACCCACAACTGG - Intergenic
924947300 1:248855266-248855288 GATTCAGAACCAGGAAGCAGAGG - Intronic
1064243573 10:13651933-13651955 GACTCAGACCCATCCAGAATGGG + Exonic
1065865790 10:29914294-29914316 GAATGAGAACCAAGCAGAAGGGG + Intergenic
1066571911 10:36782887-36782909 GTTTCAGAATCAAACAGAAGTGG - Intergenic
1075738907 10:124681497-124681519 GTTTCAGAAATACCCAGGAGTGG - Intronic
1077943680 11:6871366-6871388 GAGTCAGATCTGCCCAGAAGAGG - Intergenic
1078526078 11:12102521-12102543 AATTCAGAACCATCCAGGAAAGG + Intronic
1079025704 11:16946139-16946161 GAAGCAGAAGCACCCAGACGGGG - Intronic
1080569399 11:33542500-33542522 GATCCAGAAACACCTAGATGAGG - Exonic
1080627445 11:34043291-34043313 TATTCACAACAACCAAGAAGTGG + Intergenic
1080962847 11:37180563-37180585 AATTCAGCAGCTCCCAGAAGAGG + Intergenic
1081569772 11:44282543-44282565 TATTCAGAATCACCCCGAAATGG + Intronic
1082032248 11:47613442-47613464 GTTTTAGAAGCACCCAGTAGAGG + Intergenic
1084669281 11:70595735-70595757 GATTGAGGCTCACCCAGAAGTGG + Intronic
1084958498 11:72703864-72703886 GATTCAGAAGCAACCGGACGGGG + Intronic
1090132858 11:124162800-124162822 GATTTAGAACAAACCAGCAGGGG - Intergenic
1091252402 11:134154620-134154642 GGTACAGCACCACCCAGGAGGGG - Intronic
1092955674 12:13547364-13547386 GAATCATGGCCACCCAGAAGAGG + Exonic
1096622960 12:52875839-52875861 CAGTCAGAACCACCAAAAAGAGG + Intergenic
1101112759 12:101502261-101502283 GATTAAGAACAACCCCCAAGGGG - Intergenic
1102418046 12:112781485-112781507 GGTCCCGAACCACACAGAAGAGG - Intronic
1103583573 12:121934610-121934632 CATTAAGAACTGCCCAGAAGAGG - Intronic
1104159769 12:126167072-126167094 GATTCAGTACCACCCTGAGAAGG + Intergenic
1104160141 12:126170735-126170757 CCTGCAGAACAACCCAGAAGTGG - Intergenic
1105707488 13:22977197-22977219 GGCTAGGAACCACCCAGAAGAGG + Intergenic
1109702866 13:66049077-66049099 GAATGAGAACCAACCAAAAGGGG + Intergenic
1109965991 13:69696576-69696598 CTGTCAGAACCAACCAGAAGAGG + Intergenic
1110194512 13:72771820-72771842 GATCAAGAATCAGCCAGAAGAGG - Exonic
1114152166 14:20054559-20054581 GAGGCAGAACCACCCCCAAGAGG - Intergenic
1124664860 15:31583595-31583617 GAATGAGAACCAAGCAGAAGGGG - Intronic
1130232370 15:82106877-82106899 GACTCAGAAGCACCTAGGAGTGG + Intergenic
1132079386 15:98851716-98851738 GAGTCAAGACCAACCAGAAGGGG + Intronic
1135645865 16:24161556-24161578 GATGCAAAAGCTCCCAGAAGGGG + Intronic
1139435074 16:66932226-66932248 GATTCACAACCTCCAAGAGGTGG + Exonic
1142127199 16:88416067-88416089 GATTCCGAACCCCACAGCAGCGG + Intergenic
1144176935 17:12716527-12716549 GATTCAGACCCACCAGGAACTGG - Intronic
1145038286 17:19556468-19556490 GCTTCAGAACCAGGCAGGAGCGG - Intronic
1146626467 17:34439024-34439046 GCTTCAAAACAAGCCAGAAGAGG + Intergenic
1150143491 17:62749769-62749791 CATTCAGAACCACTCGGAGGAGG - Intronic
1150929960 17:69573646-69573668 GAGTCAGAATAACCCAGATGAGG - Intergenic
1152292502 17:79448187-79448209 GGTTCAGGAGCCCCCAGAAGAGG + Intronic
1155068179 18:22286803-22286825 GCTTAAGAAACACCCAGAACTGG - Intergenic
1156680643 18:39584675-39584697 GATTCAGAACCACACAAGGGTGG + Intergenic
1157797881 18:50592204-50592226 GATAAAGAAACAGCCAGAAGAGG + Intronic
1157864065 18:51165867-51165889 TACTAAGAACAACCCAGAAGAGG + Intergenic
1158584573 18:58719925-58719947 TATTCAGAAGCACCTAGAAAAGG - Intronic
1159581126 18:70235686-70235708 GATTCAGAACCTCCAAGGCGTGG - Intergenic
1160288346 18:77567738-77567760 ACTTCATAACCACCCAGAAAAGG - Intergenic
1164788957 19:30959743-30959765 GATTCAGAAGTACTCAGGAGAGG + Intergenic
1167208029 19:48115681-48115703 GATTCAGAACCAACAAGGCGAGG - Exonic
926594756 2:14778070-14778092 GATTCAGAACTAAACAGACGAGG - Intergenic
930823971 2:55677131-55677153 GATTCAGAACCAACCTGTAAGGG - Intronic
933015884 2:77126731-77126753 GATTTAGAAACACCTGGAAGTGG + Intronic
934550924 2:95261125-95261147 GACTCATGACAACCCAGAAGAGG + Intergenic
934994582 2:98945699-98945721 GAATCACAACCATCCAGAGGAGG - Intergenic
937798142 2:126050015-126050037 GCTTCAGGACCACCCAGTGGAGG - Intergenic
938790262 2:134669989-134670011 GGGCCAGAACCACCCAGATGAGG + Intronic
941041965 2:160633324-160633346 GATTCAGATGCACCCAAAAGAGG - Intergenic
946246437 2:218390492-218390514 GACTGAGATCCACTCAGAAGGGG - Intronic
948900500 2:240954477-240954499 AATTCAAGACCAGCCAGAAGAGG + Intronic
1169145841 20:3251855-3251877 GCTAAAGAACCACCCACAAGGGG + Exonic
1169571476 20:6911365-6911387 GAGACAGAAGCTCCCAGAAGTGG + Intergenic
1170570974 20:17632431-17632453 GAAGCAGACCCACTCAGAAGAGG - Intronic
1170741692 20:19064176-19064198 GAATCAGAACCAAGCAAAAGGGG - Intergenic
1176988485 21:15465255-15465277 GAATGAGAACCAACCAAAAGGGG - Intergenic
1178736915 21:35160818-35160840 GATTCAGTTCCTCCAAGAAGAGG + Intronic
1179516747 21:41913812-41913834 GATTCAGAACCACCCAGAAGGGG + Intronic
1180892584 22:19300853-19300875 TATTTAGAAGCATCCAGAAGAGG + Intergenic
1181637689 22:24181904-24181926 GATTCAGCCCCACCCTGATGAGG - Intronic
1182045069 22:27267829-27267851 GGATCAGAAACACCCAGACGTGG - Intergenic
1184562698 22:45272632-45272654 GAGTCAGATCCACCCCCAAGTGG - Intergenic
949603185 3:5623709-5623731 TATTCATAACCACCCAAAACTGG - Intergenic
949628788 3:5899110-5899132 TATTCAGAACGGCCCAGTAGGGG + Intergenic
950226449 3:11238940-11238962 TATTCATAACCACCAAAAAGTGG - Intronic
953165210 3:40458822-40458844 GATTCAGAGCCATCCTGAAGAGG + Intronic
953414328 3:42707010-42707032 GCAGCAGAACCACCCTGAAGTGG + Intronic
953896376 3:46806362-46806384 GACTCAGAACCAATCAGAAGAGG - Intronic
954752112 3:52819580-52819602 GCTTGAGATCCACCCAGGAGTGG + Exonic
955239005 3:57164005-57164027 TGTTTAGAGCCACCCAGAAGAGG + Intronic
959676825 3:109045185-109045207 GATGCAGAACCACCTGAAAGTGG - Intronic
963086277 3:141439534-141439556 GAATCAGAACCCCACAGAAGTGG + Intronic
966259403 3:177956976-177956998 GATTCTGGTCCACCAAGAAGGGG - Intergenic
966369735 3:179236877-179236899 GATACTGAAGTACCCAGAAGTGG - Exonic
968498009 4:929129-929151 GAGTCAGGACCACACACAAGTGG + Intronic
968582360 4:1401007-1401029 GATTCAGACCCACTCAGAGCCGG - Intergenic
969054577 4:4393661-4393683 GATTCACAACTGCCCTGAAGGGG + Intronic
969445354 4:7241739-7241761 CACTCAGAAGCACCCAGAATCGG - Intronic
970197733 4:13569176-13569198 GCTTCAGAACAGCACAGAAGAGG + Exonic
970663062 4:18307820-18307842 GATTGAGAAATACCCAGATGTGG - Intergenic
971325962 4:25643984-25644006 GCTTCAGAAACACACAGAACTGG + Intergenic
971603396 4:28625047-28625069 GAAGCAGAACCAGCCAGAAGAGG + Intergenic
975392169 4:73833199-73833221 TCTTCAGAACCAGCCAGAAGAGG + Intergenic
975406904 4:74000036-74000058 TCTTCAGAACCAGCCAGAAGAGG - Intergenic
977022999 4:91778970-91778992 AATTCAGAACTACCCAGAAATGG + Intergenic
978016141 4:103749026-103749048 GAATGAGTATCACCCAGAAGTGG + Intergenic
979117126 4:116839915-116839937 GATTCATAGCCACCAAAAAGAGG - Intergenic
982300968 4:153879227-153879249 CCTTCAAAGCCACCCAGAAGTGG - Intergenic
982555727 4:156861539-156861561 GATTCTGAACCACCTAGATTAGG - Intronic
986739556 5:10694183-10694205 GATTCAGAACCACGCAAAGGAGG + Intronic
987266561 5:16262285-16262307 GCCTCAGAACCACCCATCAGGGG + Intergenic
988881027 5:35502716-35502738 ACTTCAGAACCACCCATAAGAGG - Intergenic
990468843 5:56094783-56094805 GATTCAGCTACACCCAGAAATGG - Intergenic
991507904 5:67343786-67343808 GATCCAGATCCAGCAAGAAGGGG - Intergenic
993506690 5:88717247-88717269 GATTGAGAAAGGCCCAGAAGGGG - Intergenic
996558067 5:124799216-124799238 AATTCAGATCCATCCAGATGAGG + Intergenic
997284877 5:132670740-132670762 AAATCAGAACCAGCCAAAAGAGG - Intergenic
997609104 5:135199580-135199602 AATTCAGAACCACACTGATGTGG - Intronic
998162344 5:139820730-139820752 GATTCAGAGCTGCCCAGCAGAGG + Intronic
1000457070 5:161463014-161463036 GATCAAGGAGCACCCAGAAGTGG - Intronic
1001012180 5:168108647-168108669 GCTTCAGAACCAGGCAGACGTGG - Intronic
1001613288 5:173021413-173021435 GAATCAGAACCAAGCAAAAGGGG + Intronic
1005848545 6:29801424-29801446 GGTACAGAACCTTCCAGAAGTGG + Intergenic
1005868740 6:29957600-29957622 GGTACAGAACCTTCCAGAAGTGG + Intergenic
1008823763 6:55666131-55666153 GATTCAGAACCAAAAAAAAGAGG - Intergenic
1009935836 6:70233445-70233467 GATTCAGAATCACCCACTAAAGG + Intronic
1011414386 6:87102336-87102358 GATTCAGAACCACCCAGATAAGG - Intergenic
1013272721 6:108558981-108559003 GATTCCGAACAACTGAGAAGGGG - Intergenic
1016298931 6:142607920-142607942 GATTGAAAACCTCTCAGAAGTGG + Intergenic
1016299027 6:142609127-142609149 GATTGAAAACCTCCCAGAAGAGG - Intergenic
1016362879 6:143286936-143286958 GAAACAGAACCACCGAGAATGGG - Intronic
1019789874 7:3004221-3004243 GATCCAGGACCACCCAGAGTGGG + Intronic
1021790674 7:24202080-24202102 TATTCAAAACCACCCAGCAATGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1028649161 7:93131296-93131318 TATTCAGGTCCACTCAGAAGTGG - Exonic
1030684515 7:112470920-112470942 GATGCAGAACCAACCAGATATGG + Intronic
1030938587 7:115617042-115617064 GATTGAGAACCAAGCAAAAGAGG + Intergenic
1032506383 7:132437742-132437764 GATACAGCAAAACCCAGAAGTGG + Intronic
1033427858 7:141261668-141261690 GAGGCAGAAGCACCCAGCAGAGG - Intronic
1033678678 7:143570314-143570336 GTTTCAGATCCAGCCAGATGGGG + Intergenic
1033693160 7:143759136-143759158 GTTTCAGATCCAGCCAGATGGGG - Intergenic
1035783212 8:2244751-2244773 GATTGAGAACCACGCACACGTGG + Intergenic
1035808912 8:2474835-2474857 GATTGAGAACCACGCACACGTGG - Intergenic
1036387892 8:8297625-8297647 GATTCATAACCTCCCTGTAGGGG + Intergenic
1040731459 8:50452615-50452637 GAATGAGAACCATTCAGAAGTGG - Intronic
1043594061 8:81863877-81863899 GAGCCAGAGCCTCCCAGAAGAGG - Intergenic
1046975213 8:120267524-120267546 TATTATGTACCACCCAGAAGTGG + Intronic
1048205526 8:132412337-132412359 GAGTCAGAATCACCCAGAAGGGG - Intronic
1048598439 8:135892317-135892339 GAATCAGAACCAAGCAAAAGAGG + Intergenic
1048909247 8:139118788-139118810 GATTGAGAACTGGCCAGAAGCGG + Intergenic
1051245803 9:15109544-15109566 CATTCAGAACAGCCAAGAAGTGG + Intergenic
1051535992 9:18158450-18158472 GATTCAGATCCACCCTCAATGGG - Intergenic
1052399695 9:27985240-27985262 GATTCAGAACCAAAAATAAGTGG - Intronic
1052761846 9:32600830-32600852 GACTCAGAAGCAAACAGAAGAGG + Intergenic
1056803857 9:89713022-89713044 GCTTCAGAACAGCCCAGCAGTGG + Intergenic
1057941631 9:99290036-99290058 GATGAAGAACCACCCAGAACTGG - Intergenic
1060480380 9:124013771-124013793 GGTTCTGAACCGCCCAGAAATGG + Intronic
1062651385 9:137579461-137579483 GCATCAGGACCCCCCAGAAGCGG + Intergenic
1186342243 X:8657279-8657301 GAATCTGAACCAGCCAAAAGAGG - Intronic
1187610110 X:20933459-20933481 AATTCTGCACCACCCAGAAATGG + Intergenic
1190810436 X:53878220-53878242 CTTTCAGAACCACCCCTAAGTGG - Intergenic
1194073476 X:89358137-89358159 GATTAAGAATAACCAAGAAGTGG - Intergenic
1196347581 X:114682754-114682776 GTTTCAGAATCACCAAGAAAAGG - Intronic
1197249304 X:124198292-124198314 GAATGAGAACCACGCAAAAGGGG + Intronic
1197311209 X:124908020-124908042 AAATCAGAACTACCTAGAAGTGG - Intronic
1198315836 X:135465140-135465162 GTTTCAGAGCCACACAGATGCGG - Intergenic
1200728857 Y:6709714-6709736 GATTAAGAATAACCAAGAAGTGG - Intergenic
1201321288 Y:12700777-12700799 GTTTTAGAACCACCAAAAAGGGG - Intergenic
1201674488 Y:16564004-16564026 GAATGAGAACCAACCAAAAGGGG + Intergenic