ID: 1179517723

View in Genome Browser
Species Human (GRCh38)
Location 21:41920192-41920214
Sequence ACAGCTCCTGGATTTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179517713_1179517723 10 Left 1179517713 21:41920159-41920181 CCCCTGTGACTGCCGCTAAGGCA 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG 0: 1
1: 0
2: 4
3: 25
4: 219
1179517715_1179517723 8 Left 1179517715 21:41920161-41920183 CCTGTGACTGCCGCTAAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG 0: 1
1: 0
2: 4
3: 25
4: 219
1179517714_1179517723 9 Left 1179517714 21:41920160-41920182 CCCTGTGACTGCCGCTAAGGCAG 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG 0: 1
1: 0
2: 4
3: 25
4: 219
1179517717_1179517723 -2 Left 1179517717 21:41920171-41920193 CCGCTAAGGCAGGCAGCCCTGAC 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG 0: 1
1: 0
2: 4
3: 25
4: 219
1179517711_1179517723 30 Left 1179517711 21:41920139-41920161 CCAAAAGCAACGAACAGACTCCC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG 0: 1
1: 0
2: 4
3: 25
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179517723 Original CRISPR ACAGCTCCTGGATTTGGGCC TGG Intronic
900955041 1:5881462-5881484 ACAGCGCCTGGATTTTGGAAAGG + Intronic
900965209 1:5952696-5952718 ACACCTCCTGGAAGTGGTCCTGG + Exonic
902690656 1:18108371-18108393 AGCGCTCATGGATTTGTGCCAGG + Intronic
902726429 1:18339139-18339161 AAAGCCCTTGGATGTGGGCCTGG + Intronic
902726634 1:18340477-18340499 ACAGCACCTAGAATTGTGCCTGG - Intronic
903818830 1:26085329-26085351 ACAGCTCCTGGAATAGCGCCTGG + Intergenic
904369518 1:30039759-30039781 CCAGCTCCTGGATCCTGGCCTGG - Intergenic
905038100 1:34930143-34930165 TCAGCTCCTGGCTTGGGGTCAGG + Intergenic
905041315 1:34961356-34961378 AGAGCTTCTGGATATGGGGCTGG + Intergenic
907385942 1:54125364-54125386 ACAGCTCCTGGGTTCAGGGCAGG + Intergenic
912695350 1:111837540-111837562 ACAGAGCCTGGATTTGGACCAGG + Intronic
915340040 1:155172382-155172404 ATAGCTCCTGGAGTTGGAGCTGG - Intronic
919105704 1:193147942-193147964 ACAGGTGCTGCATTTGGGGCAGG - Exonic
920902269 1:210122271-210122293 AAAGTTTCAGGATTTGGGCCGGG - Intronic
922070971 1:222193207-222193229 ACAGCAGCAGGAGTTGGGCCAGG - Intergenic
922569318 1:226624538-226624560 ACAGCACCTGGGCTTGGGCAGGG - Intergenic
922724302 1:227915323-227915345 ACAGCCCCTGCATTGGGGCCTGG - Intergenic
923318226 1:232802817-232802839 ACAGAACCAGGATTTGAGCCAGG + Intergenic
1064998684 10:21318022-21318044 GCAGCTGGTGGATTTGGGCCAGG - Intergenic
1065124761 10:22563698-22563720 ACAGCGCCAGGGTTTGAGCCTGG - Intronic
1067825479 10:49569327-49569349 GCAGCTCCTGGATTGGGGGCTGG + Intergenic
1068737383 10:60429631-60429653 ACAGTTCTTGGTTTTGGCCCTGG + Intronic
1069598488 10:69687894-69687916 ACAGCTCCTGGAATTTCACCAGG + Intronic
1069742069 10:70691115-70691137 ACAGGTCCTGCCTCTGGGCCAGG + Intronic
1070644891 10:78195065-78195087 ATGGCTCCTGCATTTGGGACAGG + Intergenic
1071651757 10:87399045-87399067 ACTGCTCCTGCATTTGGGTGGGG + Intergenic
1073262748 10:102202945-102202967 TGAGGTCCTGCATTTGGGCCTGG + Intergenic
1074531588 10:114302158-114302180 TCAGCTCCTGGCTCTTGGCCGGG + Intronic
1075231643 10:120684980-120685002 CCAGCTCCAGGATTTGGGGCAGG - Intergenic
1075964356 10:126598242-126598264 ACAGCTGCTGGAGAAGGGCCAGG - Intronic
1076543293 10:131227885-131227907 ACAGCTCCTGAATATTGACCCGG - Intronic
1076668822 10:132107987-132108009 GCAGCTCCAGGAGTTGGGTCCGG + Intronic
1076866468 10:133168773-133168795 ACAGCTCCTGGGTATGGGCGTGG + Intronic
1077340699 11:2025096-2025118 GCAGCTCCTGGAGTTGGACGAGG - Intergenic
1078373583 11:10773590-10773612 AAAGATCCTTCATTTGGGCCGGG + Intronic
1078593696 11:12668444-12668466 ACAGCTTCTGCATTTGGGAATGG - Intergenic
1078736514 11:14025522-14025544 ACAGCTCCAGGCATGGGGCCAGG - Intronic
1078776820 11:14401512-14401534 CTAGCTCTTGGAATTGGGCCTGG + Intergenic
1079679635 11:23278879-23278901 ACAGCTTCTGCATTTGTTCCTGG - Intergenic
1083150254 11:60787319-60787341 ACAGGTCCTGGAAGTGGGCCAGG + Intronic
1083783361 11:64929815-64929837 ATAGCTCCTGGACTGAGGCCGGG + Intronic
1084013857 11:66367491-66367513 CCAGCTCCTGAGCTTGGGCCTGG + Exonic
1085282281 11:75339122-75339144 ACAGCTCCAGGCTTTGGGGCTGG - Intronic
1088081629 11:105923377-105923399 GCAGCTCTGGGATTTGAGCCTGG - Intronic
1088536232 11:110865088-110865110 ACATCTCCTGGATTTCAACCAGG + Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1091251798 11:134150378-134150400 TCAGCTCCTGGGGTTGCGCCAGG + Exonic
1202823684 11_KI270721v1_random:80285-80307 GCAGCTCCTGGAGTTGGACGAGG - Intergenic
1092764290 12:11838777-11838799 ACAGCCCCTGGAACTGGGCAAGG + Intronic
1092987177 12:13856877-13856899 TAAGCACTTGGATTTGGGCCTGG - Intronic
1096634120 12:52947914-52947936 CCAGCTCCTAGAACTGGGCCTGG + Intronic
1097160074 12:57039816-57039838 ACAGGTCTGGGATGTGGGCCTGG + Intronic
1097169796 12:57106189-57106211 ACCTCTCCTGGAGTGGGGCCAGG + Exonic
1098557434 12:71835350-71835372 ACAGCTCCTGCATGGTGGCCTGG + Intergenic
1098773750 12:74587265-74587287 ATAGCTCATTTATTTGGGCCTGG - Intergenic
1098997256 12:77135087-77135109 CCTCCTCTTGGATTTGGGCCAGG - Intergenic
1102223367 12:111210001-111210023 ACAGCCCCAGACTTTGGGCCAGG - Intronic
1102483245 12:113238440-113238462 ACAGCTACTGGATTGTTGCCAGG - Intronic
1102719770 12:115005982-115006004 ACAGCTCCTGGTTCAGTGCCTGG - Intergenic
1104139802 12:125976569-125976591 ACAGTTCTTGGATTTGGAGCTGG + Intergenic
1104835349 12:131786609-131786631 GCAGGTGCTGGATGTGGGCCAGG + Intronic
1106121465 13:26863163-26863185 CCAGCTCCTGGAAATGGGACTGG - Intergenic
1106641537 13:31588967-31588989 GGAGCTGCTGGCTTTGGGCCTGG - Intergenic
1107506123 13:41035614-41035636 ATAGCTTCTGGATTTGACCCAGG + Intronic
1108935747 13:55878351-55878373 TGAGGTCCTGCATTTGGGCCCGG + Intergenic
1109215015 13:59579709-59579731 AGAGCTCTTGGATTTGGGCCTGG - Intergenic
1113662848 13:112118783-112118805 ACAGCCCCTTGATTGGGGCTTGG - Intergenic
1116604187 14:46968536-46968558 AAAATTCCTAGATTTGGGCCGGG + Intronic
1117556960 14:56895733-56895755 ACAACCCCAGGATTTGGGGCCGG + Intergenic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1119917447 14:78415103-78415125 ACAGCTCTAAGATTTGGGCAAGG + Intronic
1121025623 14:90614049-90614071 CCAGCTCCTGGAATAGTGCCTGG + Intronic
1122957245 14:105076515-105076537 CCTGCTCCAGGATTTGGGCCTGG - Intergenic
1125608774 15:40957179-40957201 ACAGCTCCAGGATCTCAGCCTGG + Intergenic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1130026738 15:80276904-80276926 CCAGATCCAGGATTTGAGCCTGG - Intergenic
1130090308 15:80815287-80815309 ACAGCACTGGGAATTGGGCCAGG - Intronic
1130650726 15:85760684-85760706 GCAGGTCCTGGACTGGGGCCGGG - Exonic
1131088347 15:89598266-89598288 AAAACTCCTGGAACTGGGCCGGG - Intronic
1132400327 15:101501270-101501292 ACAGTGCCTGGACCTGGGCCTGG + Intronic
1132726920 16:1342908-1342930 CCAGCTGCTGGAGTTGGGCTGGG - Exonic
1132896798 16:2233132-2233154 ACAGCTCCTGCATCTGGACGTGG - Exonic
1133317164 16:4892039-4892061 GCAGCTGCTGGACTTGGCCCAGG - Exonic
1133858695 16:9574045-9574067 TCAGATTCTGGATATGGGCCAGG + Intergenic
1134238665 16:12487592-12487614 CCAGCTCCTAGATTTGGGCATGG - Intronic
1135149649 16:19994617-19994639 ACAGCTCCTGGCCTGGAGCCTGG + Intergenic
1137366052 16:47860626-47860648 TCAGCACCTGGAATTGTGCCTGG - Intergenic
1137789168 16:51160219-51160241 ACAGCTGCTGGGTTTGGTCCAGG + Intergenic
1141844147 16:86595685-86595707 ACAGGTCCAGGATTGGGGCACGG - Intergenic
1143556199 17:7662302-7662324 ATAAATACTGGATTTGGGCCAGG - Intronic
1144742183 17:17590157-17590179 ACAGCTCCTGCATTTTCACCAGG - Intronic
1144797441 17:17901823-17901845 ACAGCTTGTGGATTTGGGAATGG - Intronic
1148160455 17:45447064-45447086 AGAGCTCCTGGCATAGGGCCTGG + Intronic
1148562621 17:48614533-48614555 AGAACTCCTGGATTTGCGACGGG + Exonic
1149695064 17:58610235-58610257 ACACCTCCTACATCTGGGCCAGG - Intronic
1150715412 17:67568689-67568711 ACAGCTCCTGAGTTTGGGGGTGG + Intronic
1151694281 17:75706166-75706188 ACAGCACGTGGATCTGGGCCTGG + Intronic
1152571594 17:81123532-81123554 ACAGGTGCTGGGCTTGGGCCTGG - Intronic
1153775573 18:8450688-8450710 ACTCCTCCTGGCTTAGGGCCTGG - Intergenic
1153952860 18:10071563-10071585 CCAGCACCTTGATTTTGGCCTGG + Intergenic
1154475251 18:14748560-14748582 CCAGCTTCTGGACTTGGCCCCGG - Exonic
1155916691 18:31564598-31564620 ACAGCTCATGGATCTGATCCAGG - Intergenic
1156957507 18:42986322-42986344 ACATATTCTGGATATGGGCCGGG - Intronic
1157839925 18:50947419-50947441 ACATCTCCTGGATGTGGTACGGG - Exonic
1161719847 19:5896702-5896724 ACAGCTCCAGGACTGGGGCCAGG - Intronic
1162558451 19:11402099-11402121 GCAGCTGCTGGATGCGGGCCAGG + Exonic
1163126722 19:15248268-15248290 ACAGCCCCTGGGGTTGGGGCAGG - Intronic
1163737893 19:18992645-18992667 AGAAATCCTGGCTTTGGGCCAGG - Exonic
1164735826 19:30540217-30540239 ACAGCTCCTGGATGCTGGCTGGG + Intronic
1165587741 19:36934978-36935000 ACAGCTACTGAATTTCAGCCAGG - Intronic
1165941519 19:39416853-39416875 ACAGCTCCCGGAGCAGGGCCAGG - Exonic
1166591348 19:44002370-44002392 ACAGCTTCTGGAGTAGGGGCTGG + Intergenic
1166928416 19:46285769-46285791 ACAGAGCCTGGATTTGACCCAGG + Intergenic
1167530592 19:50013708-50013730 ACAGCACCTGGGTCTGTGCCTGG - Intronic
1167571572 19:50292257-50292279 ATAGCTCCTTCATCTGGGCCTGG - Exonic
1168724091 19:58571185-58571207 ACAGCTCTCGGAGCTGGGCCAGG + Exonic
926119533 2:10234646-10234668 ACAGCCCCTGGAGTTGGGTGGGG + Intergenic
926736868 2:16080345-16080367 CCAACTCCTGAGTTTGGGCCAGG + Intergenic
927138596 2:20114747-20114769 ACTGCTCCTGGAGGTTGGCCAGG + Intergenic
931940112 2:67242697-67242719 ACAGCTCTTGGTTCTGGTCCAGG - Intergenic
932355013 2:71061142-71061164 TCAGCTCCTGGAGCTGAGCCTGG - Intergenic
935061933 2:99615884-99615906 GCAGCTGCTGGATATGGGCAGGG + Intronic
937092895 2:119218262-119218284 GCAGATCCGGGATTTGGACCAGG - Intergenic
937266992 2:120623026-120623048 ACAGCACCTGGAGATGGGGCAGG + Intergenic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
938921328 2:135997770-135997792 ACAGCTCCAGGATGTCTGCCTGG - Intergenic
942646189 2:178112967-178112989 ACAGCACCTGGCTTGGGGACAGG + Intronic
944399603 2:199310177-199310199 ACAGCTGCTGCAGATGGGCCTGG - Intronic
944449363 2:199825361-199825383 ACAGCTCCTGGAATGGGGCGGGG + Intronic
944908323 2:204284963-204284985 ACCGCACCTGGCTATGGGCCAGG + Intergenic
945585131 2:211651862-211651884 ACAGCACCTTGATTTCAGCCTGG + Intronic
946181289 2:217950672-217950694 ACAGCTCTGGGCTTTGGGCGAGG - Intronic
946362565 2:219228267-219228289 ACAGATTCTGGCTTTGGGCCAGG - Intronic
947732138 2:232437160-232437182 TCAGCTCCTGAATTGGAGCCTGG + Intergenic
948737675 2:240019897-240019919 TCAGCTCCTGGATTGGCTCCTGG + Intronic
1168760907 20:348769-348791 ACACCTCCTGGCTTTGGTTCGGG + Intronic
1172271427 20:33657713-33657735 TCTCCTCCTGGACTTGGGCCTGG - Exonic
1174206481 20:48843840-48843862 ACAGCTACTAGATTTGGACTTGG - Intergenic
1175589598 20:60178003-60178025 CCAGCTCCTGGAATGGAGCCTGG - Intergenic
1175965044 20:62656186-62656208 ACAGTGCCTGGGTGTGGGCCTGG + Intronic
1176009727 20:62886493-62886515 ACAGATCCTGGTTTTGGTCTTGG - Intronic
1177739509 21:25136688-25136710 ATTGCTCCTGGATTTGGGGAGGG - Intergenic
1178847112 21:36183062-36183084 ACAGCTCCTGCACTCTGGCCTGG - Intronic
1179155900 21:38851092-38851114 ATAGCTCCAGGATTAGGGGCAGG - Intergenic
1179238049 21:39564444-39564466 TCAGCTGCTGAATTTGTGCCAGG + Intronic
1179448378 21:41449946-41449968 ATAGCTTCAGGATTGGGGCCGGG - Intronic
1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG + Intronic
1180057209 21:45365141-45365163 CCTGCCCCTGGAGTTGGGCCAGG + Intergenic
1181096314 22:20507589-20507611 ACGGCTTCCGGGTTTGGGCCTGG + Exonic
1181109324 22:20592040-20592062 GCAGATCCTGGACTTGGACCTGG - Intergenic
1183802375 22:40177627-40177649 ACAGCTCCTGGATCTTCTCCTGG - Intronic
1184789396 22:46690024-46690046 ACAGCTCCTGGAACTGCGACGGG - Exonic
1185047926 22:48538226-48538248 CCAGCTCCTGGTTTAGGGGCGGG + Intronic
1185074560 22:48676299-48676321 ACACCTTCTGGGTCTGGGCCAGG + Intronic
1185332009 22:50256181-50256203 ACAGATCCTGGACTTCGGCCTGG - Exonic
1185334881 22:50267030-50267052 CCAGATCCTGGATTTTGGGCTGG - Exonic
953463414 3:43099522-43099544 ACTGCACATGGCTTTGGGCCTGG - Intronic
953470193 3:43159669-43159691 ACAGCCCCTGGGGTAGGGCCAGG - Intergenic
955338017 3:58103140-58103162 ACAGCACCAGGCTTTGGGTCAGG + Intronic
960996451 3:123343629-123343651 ACAGCTCCTGGAGCTCTGCCTGG - Intronic
962428697 3:135298989-135299011 ACTGATGCTGGGTTTGGGCCAGG - Intergenic
964010701 3:151887992-151888014 TCTGGTCCTGGGTTTGGGCCTGG + Intergenic
964011556 3:151898379-151898401 TCTGGTCCTGGGTTTGGGCCTGG - Intergenic
965544684 3:169903480-169903502 ACAGCTCATTGTATTGGGCCTGG + Intergenic
966330666 3:178809193-178809215 AAAACTCTTGGATTTGGTCCTGG - Intronic
966793538 3:183694220-183694242 ACAGCCACTGGAGGTGGGCCTGG - Intergenic
967104147 3:186242044-186242066 GCAGCTCCGGGACTTGGACCAGG - Intronic
968052325 3:195663546-195663568 CCAGCGGGTGGATTTGGGCCTGG + Intergenic
968103486 3:195984793-195984815 CCAGCGGGTGGATTTGGGCCTGG - Intergenic
968301788 3:197622386-197622408 CCAGCGGGTGGATTTGGGCCTGG - Intergenic
968569784 4:1333606-1333628 CCAGCTGCTGGGTTGGGGCCAGG - Intronic
968734145 4:2286509-2286531 ACAGCACCTGGATTTCAGCCTGG + Intronic
969319273 4:6401944-6401966 ACAGAGCCAGGATTTGCGCCTGG - Intronic
969460188 4:7324928-7324950 GCAGCTCCTGGATTTGACTCTGG + Intronic
969485053 4:7467538-7467560 CCAGCTCCTGAGTGTGGGCCTGG + Intronic
971353006 4:25869474-25869496 CCACCTCCTGGCTGTGGGCCTGG - Intronic
971938949 4:33189307-33189329 CCAGCTCCTTGCTTTGGGCTTGG + Intergenic
972388781 4:38592964-38592986 CCAGCACCTGGATCGGGGCCTGG - Intergenic
976368082 4:84253484-84253506 AAGGATACTGGATTTGGGCCAGG + Intergenic
980511479 4:133794675-133794697 AAAGCTCCTGGAATTGTGACTGG - Intergenic
981079979 4:140630029-140630051 ACAGGTCCAGGATTTGCACCTGG + Intronic
982382771 4:154767006-154767028 ACATCTCCAGGGTTTGGTCCTGG - Intergenic
984336908 4:178404038-178404060 ACATCTCCTGGATATGGAACAGG + Intergenic
985498535 5:225341-225363 CCAGCGGGTGGATTTGGGCCTGG + Intronic
987760819 5:22161053-22161075 AAAGCTTCAGGATTTGGGCAAGG - Intronic
989566776 5:42909113-42909135 TCAGCTCCTGCTTTGGGGCCGGG + Intergenic
991895597 5:71394506-71394528 AAAGCTTCAGGATTTGGGCAAGG - Intergenic
994576464 5:101585811-101585833 ACAGCTCGAGGACCTGGGCCTGG - Intergenic
997064835 5:130548221-130548243 AGAGGTCCTGCATTTGGGCCTGG + Intergenic
997849299 5:137316550-137316572 ACAAGTCCTGGTTGTGGGCCTGG - Intronic
998410505 5:141907016-141907038 ACAGCTCCTGGGCTTGTTCCTGG - Intergenic
1001250191 5:170141167-170141189 CCAGCTCCTTGTATTGGGCCCGG + Intergenic
1002934062 6:1656781-1656803 ACATCTTCTGGATCTGGGCTTGG + Intronic
1004293119 6:14386388-14386410 GCAACACCTGGATTTTGGCCTGG + Intergenic
1005206966 6:23415621-23415643 ACATCTTCTGTATTTGAGCCAGG + Intergenic
1005861808 6:29907869-29907891 ACAGCAGCTGGAGTTGGACCAGG - Intergenic
1006098049 6:31668463-31668485 GCAGCCCCTGGATATGGGCAGGG + Intronic
1006457304 6:34139209-34139231 ACAGCTTGTGGATTGGGGTCTGG - Intronic
1007471834 6:42095885-42095907 ACAGCACCTAGCTTTGTGCCTGG + Intergenic
1009277502 6:61701973-61701995 AGAGGTCCTGGATTTTGGACTGG + Intronic
1013816881 6:114109464-114109486 AGAGCTACTGGATTTTGGCAAGG - Intronic
1015181576 6:130366450-130366472 ACAGCTCCTGGAGTGAGACCAGG + Intronic
1016604333 6:145902160-145902182 AAAGCTCCAGAATTTGGGGCAGG + Intronic
1017808060 6:157963455-157963477 GCAGCTCCTGAAATGGGGCCAGG + Intergenic
1018291399 6:162295622-162295644 ACAACTCCTGTAGTGGGGCCAGG - Intronic
1018570684 6:165206315-165206337 AGAACTCTTGGATTTGGGCAGGG - Intergenic
1019558750 7:1645507-1645529 GCAGCCCCTGGCTGTGGGCCCGG - Intergenic
1020078750 7:5275329-5275351 ACAGCTCCTGGAGCTGGGCCAGG + Intronic
1020254890 7:6497567-6497589 ACAGCATCTGGCTCTGGGCCTGG + Intronic
1022145722 7:27538483-27538505 GCAGCCCCTGGAATTGGGCAAGG - Intronic
1022235324 7:28455238-28455260 ACAGCTCCTGCAGTTCGGCTCGG - Intronic
1022868014 7:34443021-34443043 AAAGCTCCTGGATGTAGACCAGG + Intergenic
1024550412 7:50558420-50558442 ACAGCTGCTGGCCTGGGGCCTGG + Intronic
1025200145 7:56956856-56956878 ACAGCTCCTGGAGCTGGGCCAGG - Intergenic
1025671799 7:63620076-63620098 ACAGCTCCTGGAGCTGGGCCAGG + Intergenic
1031384842 7:121136740-121136762 AAAGCTCCTGAATTTAGGCCGGG + Intronic
1033621963 7:143069832-143069854 CCAGGTCCTGCATTTGGACCTGG - Intergenic
1035034382 7:155885567-155885589 GCAGCTCCTGGGTGTGGGCTGGG - Intergenic
1035613397 8:984411-984433 CCAGCTCCTGGATTGGAGGCAGG - Intergenic
1035642397 8:1194021-1194043 ACAGTACGTGGATTTGGTCCCGG - Intergenic
1036493436 8:9248832-9248854 ACAGCTCCTGGATAGAGTCCTGG + Intergenic
1037061970 8:14524337-14524359 ACTGCTCCTGGATTCGGGTGGGG + Intronic
1039417092 8:37404774-37404796 ACAGCTTCAGGATTTGAACCTGG - Intergenic
1040296142 8:46150114-46150136 AAAGCTCCAGGATTTGGAGCAGG - Intergenic
1040333571 8:46404703-46404725 AAAGCTCCAGGATTTGGAGCAGG + Intergenic
1042599486 8:70484192-70484214 TTAGCTCCTGTATTTGGTCCAGG + Intergenic
1046785263 8:118258931-118258953 ACAGTCCCTGAGTTTGGGCCTGG - Intronic
1053341676 9:37341445-37341467 TCAGCTCCTGGAATAGGGCCAGG - Intronic
1054713900 9:68538389-68538411 TCAGCTACTGGCTTTGGGCCTGG - Intronic
1055033236 9:71791729-71791751 TCAGCTCCTGGAATGGGGCCTGG - Intronic
1056303414 9:85265979-85266001 ACAGCACCTGGAATTTGGTCTGG - Intergenic
1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG + Intronic
1059073784 9:111167471-111167493 TCAGCTCCAGGATTTCTGCCTGG - Intergenic
1059662285 9:116413933-116413955 CCAGCTCCTGAAATTGGGCATGG - Intergenic
1062454813 9:136630408-136630430 CCAGCTCCTGGAGCTGAGCCAGG + Intergenic
1203787052 EBV:133903-133925 AGAGCTGCTGGAGCTGGGCCCGG + Intergenic
1185791272 X:2929358-2929380 TCAGCTGCGGGATCTGGGCCGGG + Intergenic
1187415856 X:19092731-19092753 ACAACTCCTGGACTAGGTCCTGG - Intronic
1188444618 X:30243139-30243161 AGAGCTACTGGATGTGGCCCTGG - Exonic
1191240707 X:58187957-58187979 ACATATCCTGGATTTGGCCAGGG - Intergenic
1191898977 X:66022061-66022083 CCAGCTGCTGGATTTGGCTCTGG - Exonic
1192292804 X:69815417-69815439 ACAGCTTCTGGAGTTGGGGTGGG + Intronic
1192506059 X:71684603-71684625 TGAGTTCATGGATTTGGGCCTGG + Intergenic
1192520638 X:71796945-71796967 TGAGTTCATGGATTTGGGCCTGG - Intergenic
1193669792 X:84370219-84370241 GAAGCTGCTGGATTTGGGACTGG + Intronic
1195323795 X:103741906-103741928 ACAGCACCTAGCTTAGGGCCAGG + Intergenic
1198466668 X:136909863-136909885 AGAGCTCATGGACTTGGACCCGG + Intergenic
1199837505 X:151606632-151606654 ACAGGTCTTGGATTTGGGCAAGG - Intronic
1200147502 X:153934350-153934372 GCAGCTTCTGAATTTGGGCATGG - Intronic