ID: 1179519264

View in Genome Browser
Species Human (GRCh38)
Location 21:41931737-41931759
Sequence CTGACAAAAGGGCTGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179519256_1179519264 0 Left 1179519256 21:41931714-41931736 CCTGGCCAAGTGTCTTTTATATG 0: 1
1: 0
2: 4
3: 47
4: 360
Right 1179519264 21:41931737-41931759 CTGACAAAAGGGCTGTTGGGGGG 0: 1
1: 0
2: 2
3: 19
4: 229
1179519255_1179519264 5 Left 1179519255 21:41931709-41931731 CCATGCCTGGCCAAGTGTCTTTT 0: 1
1: 5
2: 78
3: 897
4: 7986
Right 1179519264 21:41931737-41931759 CTGACAAAAGGGCTGTTGGGGGG 0: 1
1: 0
2: 2
3: 19
4: 229
1179519254_1179519264 8 Left 1179519254 21:41931706-41931728 CCACCATGCCTGGCCAAGTGTCT 0: 2
1: 12
2: 273
3: 2896
4: 31773
Right 1179519264 21:41931737-41931759 CTGACAAAAGGGCTGTTGGGGGG 0: 1
1: 0
2: 2
3: 19
4: 229
1179519257_1179519264 -5 Left 1179519257 21:41931719-41931741 CCAAGTGTCTTTTATATGCTGAC 0: 1
1: 0
2: 1
3: 13
4: 223
Right 1179519264 21:41931737-41931759 CTGACAAAAGGGCTGTTGGGGGG 0: 1
1: 0
2: 2
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179519264 Original CRISPR CTGACAAAAGGGCTGTTGGG GGG Intronic
900931995 1:5743527-5743549 CTGACGAAGGGGCTGTCGGCTGG - Intergenic
900932382 1:5745561-5745583 ATGATCAAAGGGCTGTTGGAAGG - Intergenic
901204632 1:7487003-7487025 CTGACTCAAGGGTTGTTGGGAGG + Intronic
901363684 1:8727099-8727121 CTGAAAAAAGGTCAGTTGGCTGG - Intronic
902761182 1:18581645-18581667 CTGTCCAAAGAGCTCTTGGGCGG - Intergenic
904024356 1:27492732-27492754 ATGACAAAAGGGCAGTTGTGAGG + Intergenic
904527823 1:31147405-31147427 CTGCCACAAGGGCTGCTGGTTGG + Intergenic
907039448 1:51245447-51245469 CAAAAAAAAAGGCTGTTGGGTGG - Intronic
907232294 1:53010980-53011002 CTCACACAAAGCCTGTTGGGTGG + Intronic
907891306 1:58639169-58639191 CTGTCAAAAGGGTTGCTAGGAGG - Intergenic
907897358 1:58704190-58704212 CTGACACAAAGTCTGTTTGGTGG + Intergenic
911339881 1:96623342-96623364 CTCACAAAAAGCCTGTTTGGTGG - Intergenic
912799357 1:112711539-112711561 CTGCCTTAAGGGCTGTTGTGAGG - Intronic
913420519 1:118662727-118662749 CTGGCATAAGGGATGTAGGGAGG + Intergenic
913521833 1:119651851-119651873 CTGAGAAAAGGGGTGTGGGAAGG + Intergenic
915115285 1:153594719-153594741 ATGACAAAATGGTAGTTGGGGGG - Intergenic
916081840 1:161238298-161238320 ATGACAAAAGTGCTGGTTGGTGG + Intronic
917646165 1:177030773-177030795 CTGACATTAGGGCTCGTGGGTGG - Intronic
918077789 1:181183489-181183511 CTGGCGAAAGGACTGTTGGTGGG + Intergenic
920282415 1:204854089-204854111 CAGGCAAAAAGGCTGGTGGGTGG - Intronic
922999392 1:229994226-229994248 CTGCCATAAGGGCAGCTGGGAGG + Intergenic
923721550 1:236471271-236471293 CTGACCCAAGGGCTTTTGGTGGG - Intronic
1063208636 10:3858122-3858144 CCGACAAAAGGGCTTGAGGGAGG + Intergenic
1066967911 10:42286657-42286679 CTGAGAAAAGGGCATATGGGTGG - Intergenic
1069563794 10:69450172-69450194 CTGAGAAAAGGCCAGGTGGGAGG + Intergenic
1070377774 10:75850576-75850598 CTGAGAGAATGGCTGTTGAGTGG + Intronic
1070767187 10:79063510-79063532 CCCACAAAAGGGCTGTTGTGAGG + Intergenic
1070814032 10:79312195-79312217 TTGAGAAGAGGGATGTTGGGGGG + Intronic
1073348099 10:102799755-102799777 CTGACACAGGGGTTGATGGGGGG - Intronic
1076240881 10:128906359-128906381 GTGCCTAGAGGGCTGTTGGGAGG - Intergenic
1076709064 10:132321107-132321129 CTGGTCAAAGGGATGTTGGGGGG + Intronic
1077002905 11:333790-333812 CTGACACAAAGCCTGTTTGGTGG - Intergenic
1078240764 11:9529348-9529370 CTCAGAAAGGGGCTGTTGGGCGG + Intergenic
1079370450 11:19847796-19847818 CGCATCAAAGGGCTGTTGGGAGG - Intronic
1083228407 11:61299542-61299564 GAGACAAAAGGGCTGTGGCGTGG + Exonic
1083839687 11:65297156-65297178 CTTACCAAAGGGCAGGTGGGAGG + Exonic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1085835933 11:79956419-79956441 CTGATAAAAGAGGAGTTGGGTGG + Intergenic
1086061164 11:82701307-82701329 CTAACTACAGGGCTGTTGTGAGG - Intergenic
1086504875 11:87494697-87494719 CTCACAAAAAGCCTGTTTGGTGG - Intergenic
1089325998 11:117657464-117657486 CTGACAAAAGGACTTGTGGCAGG - Intronic
1089828199 11:121298738-121298760 CTCACACAAAGGCTGTTTGGTGG - Intronic
1089866454 11:121637224-121637246 CTATCAAAAGGGTTGTTTGGAGG - Intergenic
1089910963 11:122100573-122100595 GAGAAAAAAGGGCAGTTGGGTGG + Intergenic
1090378406 11:126307803-126307825 CTTACAAGAGGGCTGTTTTGAGG - Intronic
1091256717 11:134194282-134194304 CTGAAAAATGGGATGTTGTGAGG - Intronic
1092039403 12:5370715-5370737 CAGAGAAAAGGGCTGCTGGAGGG - Intergenic
1092345541 12:7711682-7711704 CTGACTATAGGGGGGTTGGGAGG + Intronic
1096807543 12:54149648-54149670 CTGAAAAAAGGACTGTCTGGTGG + Intergenic
1097450531 12:59732978-59733000 CACCCAAAAGGGCTCTTGGGAGG + Intronic
1100157994 12:91823943-91823965 CTGACAAATGGTCTGTGGGAAGG + Intergenic
1103347904 12:120263661-120263683 CTGATAAAAGGGTTGTTGTGAGG + Intronic
1106544814 13:30721241-30721263 CTGTCAAATGGGTTGTTTGGGGG + Intronic
1107541313 13:41391796-41391818 CACACACAGGGGCTGTTGGGGGG - Intergenic
1108208869 13:48118229-48118251 CTGACCCAAGGGCCTTTGGGAGG + Intergenic
1109865566 13:68259485-68259507 CTGATAAAAGCCCTGTGGGGAGG + Intergenic
1109945507 13:69426222-69426244 CTCACAAAAAGCCTGTTTGGTGG + Intergenic
1111521118 13:89405972-89405994 CTCACACAAAGGCTGTTTGGTGG - Intergenic
1113694695 13:112336092-112336114 CTGACACCTGGGGTGTTGGGAGG - Intergenic
1116929820 14:50679162-50679184 CTCACACAAGGCCTGTTCGGTGG - Intergenic
1116948789 14:50859754-50859776 CTGACAAAGGGGCTCTTGTCAGG + Intronic
1119177341 14:72578835-72578857 CTGATGAAAGGGATGTTGAGGGG + Intergenic
1120437571 14:84500273-84500295 CTCACACAAAGTCTGTTGGGTGG - Intergenic
1121277717 14:92679188-92679210 CTGACAAAAGGGCTGGATGCAGG - Intronic
1122325552 14:100879166-100879188 GTGGCAAAATGGCTGTTGTGAGG - Intergenic
1122758020 14:103997817-103997839 CTGACAACAGCCCCGTTGGGAGG - Intronic
1123039845 14:105486024-105486046 CTGACAGGAGGGATGGTGGGTGG + Intergenic
1123060390 14:105591767-105591789 CTGCCAAGAGGGCTGCTGTGGGG + Intergenic
1123084868 14:105712738-105712760 CTGCCAAGAGGGCTGCTGTGGGG + Intergenic
1123471492 15:20557455-20557477 CTTATAAAAGGGCTTGTGGGTGG + Intergenic
1123646511 15:22442900-22442922 CTTATAAAAGGGCTTGTGGGTGG - Intergenic
1123731794 15:23152457-23152479 CTTATAAAAGGGCTTGTGGGTGG + Intergenic
1123749931 15:23349839-23349861 CTTATAAAAGGGCTTGTGGGTGG + Intergenic
1124282299 15:28373735-28373757 CTTATAAAAGGGCTTGTGGGTGG + Intergenic
1124300402 15:28537880-28537902 CTTATAAAAGGGCTTGTGGGTGG - Intergenic
1124484219 15:30101328-30101350 GTGAGAAAAGGGCGGTGGGGAGG - Intergenic
1124490602 15:30152671-30152693 GTGAGAAAAGGGCGGTGGGGTGG - Intergenic
1124519363 15:30395896-30395918 GTGAGAAAAGGGCGGTGGGGAGG + Intergenic
1124539292 15:30570325-30570347 GTGAGAAAAGGGCGGTGGGGAGG - Intergenic
1124752931 15:32385658-32385680 GTGAGAAAAGGGCGGTGGGGTGG + Intergenic
1124974674 15:34521358-34521380 GTGAGAAAAGGGCGGTGGGGCGG + Intergenic
1125848834 15:42885138-42885160 CTCACACAAAGGCTGTTTGGTGG + Intronic
1126315491 15:47365026-47365048 ATAACAAAAGGGAAGTTGGGAGG + Intronic
1126370303 15:47938941-47938963 CTGACAAAAGTGTTGGTAGGTGG + Intergenic
1127142373 15:55991276-55991298 TTAACAAAAGGGGTGTTTGGGGG + Intronic
1127378345 15:58405809-58405831 AGGAGAGAAGGGCTGTTGGGTGG + Intronic
1128813537 15:70588628-70588650 CTTGGAAAATGGCTGTTGGGTGG - Intergenic
1129468912 15:75739342-75739364 GTGAGAAAAGGGCGGTGGGGAGG - Intergenic
1130304280 15:82702729-82702751 CTCACACAAAGCCTGTTGGGTGG + Intronic
1132715415 16:1287780-1287802 CTCACAAAGTGCCTGTTGGGAGG + Intergenic
1132810069 16:1793162-1793184 GTGACAGAAGGGCAGTCGGGGGG - Intronic
1134065082 16:11223191-11223213 CTGGGACAAGGGCGGTTGGGCGG + Intergenic
1134332414 16:13263244-13263266 CTGACAATAGAGTTATTGGGAGG - Intergenic
1138281389 16:55774462-55774484 CTGACAGAGGGGACGTTGGGAGG + Intergenic
1141163426 16:81644469-81644491 CGGCCAAAAGGGCAGTTTGGGGG + Intronic
1141246066 16:82309007-82309029 CTGAGAGAAGGGCTGATGGTGGG - Intergenic
1142159294 16:88548328-88548350 CAGACCACAGGGCTGGTGGGTGG - Intergenic
1142161596 16:88560609-88560631 CAGAGAAAAGGGCTGATGGGCGG + Intergenic
1143235291 17:5394309-5394331 TTGAGAAAAGGGCTGCTGGCGGG + Intronic
1143774215 17:9187028-9187050 CTGCCACTAGGGCTGTTGTGAGG + Intronic
1143967623 17:10768074-10768096 CTGAGAATGGTGCTGTTGGGGGG - Intergenic
1146293797 17:31632411-31632433 CTCACAAAAAGCCTGTTTGGTGG + Intergenic
1146974592 17:37099675-37099697 ATGGCAAGAGGGCTGATGGGAGG + Intronic
1147037378 17:37691865-37691887 CTGACAAGGGGGCAGGTGGGTGG - Intronic
1147636543 17:41967555-41967577 CCCACAGAAGGGCTGGTGGGGGG - Intronic
1149451258 17:56751755-56751777 CTGACATCAGGGCTGCAGGGAGG - Intergenic
1151029837 17:70723970-70723992 CTCACACAAGGTCTGTTTGGTGG - Intergenic
1151547342 17:74801184-74801206 CTGACAAGAGGTGCGTTGGGAGG - Intronic
1151924812 17:77187374-77187396 CAGAAAAAAGGGGTGTGGGGGGG - Intronic
1152770227 17:82163042-82163064 CTGAGGAAGGGGCTGTGGGGAGG - Intronic
1155038005 18:22041657-22041679 CTGACAAGAGGCCTGTGGGTGGG - Intergenic
1157569622 18:48703869-48703891 CTGCCAAAAGGGCTGTGGCCAGG + Intronic
1157825601 18:50809248-50809270 CTTACAAAACAGCTGCTGGGAGG + Intronic
1158308043 18:56128017-56128039 CTGACATAAGGGCTGGTGGGTGG - Intergenic
1160255646 18:77246549-77246571 CTGACAAGACTGCAGTTGGGTGG - Intergenic
1160455488 18:78996102-78996124 CTGCCAAAAGGGCCCATGGGAGG + Intronic
1160552677 18:79705080-79705102 CTGCCACCAGGGCTGTTGGGTGG + Intronic
1160901686 19:1432014-1432036 CTGACAGGAGGGGAGTTGGGTGG + Intronic
1161725182 19:5924486-5924508 CTGACAAAAGTCCTGTGGGACGG - Intronic
1163100928 19:15095942-15095964 CTGGCAAATGGACAGTTGGGAGG - Intergenic
1163842981 19:19622707-19622729 CAAACAAAAGGGCAGTGGGGAGG + Intergenic
1165431569 19:35776062-35776084 ATGAGAAAGGGGCTGTGGGGAGG - Intronic
1165710812 19:38009594-38009616 CTCTCAATAGGGCTGTTGAGAGG - Intronic
1167719214 19:51167343-51167365 CAGAGAAGAGGGCTGTGGGGAGG - Intergenic
1168494388 19:56837770-56837792 GTGACAGCAGGGCTGTTGGAGGG - Intronic
925192881 2:1899503-1899525 CTGACAGAGGGGCTGAGGGGAGG - Intronic
926863713 2:17336236-17336258 CTCACACAAGGCCTGTTTGGTGG + Intergenic
926951892 2:18252254-18252276 CTGACTGCAGGGCTTTTGGGGGG + Intronic
929958904 2:46481084-46481106 CTACCAAAAAGGCTGTCGGGTGG - Intronic
932227665 2:70055609-70055631 CACACATCAGGGCTGTTGGGGGG + Intergenic
932622072 2:73270672-73270694 GTGCCAAAAGGGGTGTGGGGAGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933702482 2:85265382-85265404 CTGGCACCAGGGCTGCTGGGAGG - Intronic
933834448 2:86233970-86233992 CTGACAAGAGGGCTGCTGGTGGG + Intronic
934311739 2:91873251-91873273 CTGAGAAAAGGGCATATGGGTGG + Intergenic
934886643 2:98031077-98031099 CTCACACAAAGGCTGTTTGGTGG - Intergenic
936794645 2:116190566-116190588 CTCACAAAAAGCCTGTTTGGTGG - Intergenic
937930190 2:127198846-127198868 CTGAGAAATGCGTTGTTGGGTGG - Intronic
938251753 2:129821217-129821239 CTGAGAAAAGGCCTGTTGGGTGG + Intergenic
938316069 2:130328972-130328994 CTGAGAGAAGGGCTGGTGGCTGG - Intergenic
938703687 2:133901170-133901192 CAAAGAAAAGGGCTGTTGGGAGG - Intergenic
939666741 2:144962423-144962445 GTGACAAAAAGGCTGTAGGGAGG - Intergenic
942522432 2:176818719-176818741 CTGAGACACGGGCTGTTGGCTGG - Intergenic
943460624 2:188168711-188168733 CTCACACAAAGGCTGTTTGGTGG - Intergenic
946746157 2:222847944-222847966 CTCACACAAAGCCTGTTGGGTGG - Intergenic
947680604 2:232028634-232028656 ATGAAAAATGGGCTGTTTGGAGG - Intronic
948230452 2:236345319-236345341 CTGACAGAGGAGCGGTTGGGGGG - Intronic
1172931920 20:38592419-38592441 CTCACACAAAGGCTGTTTGGTGG - Intergenic
1175569927 20:60010736-60010758 GTGAGAAGAGGGCTGTTTGGAGG + Intronic
1176686179 21:9850310-9850332 CTCACAAAAAGCCTGTTTGGTGG + Intergenic
1179519264 21:41931737-41931759 CTGACAAAAGGGCTGTTGGGGGG + Intronic
1179604011 21:42500426-42500448 CTGTAAAATGGGCTGTTGTGAGG + Intronic
1180538489 22:16419068-16419090 CTGAGAAAAGGGCATATGGGTGG + Intergenic
1180723538 22:17927572-17927594 CTGAGTACAGGGGTGTTGGGAGG - Intronic
1181965542 22:26654173-26654195 CAGAGATAAGGGCTGATGGGAGG - Intergenic
1183327937 22:37204557-37204579 ATGAGAAATGGGCAGTTGGGGGG - Exonic
950979883 3:17291089-17291111 CTGCCAACATGACTGTTGGGAGG + Intronic
952158624 3:30670862-30670884 CTGAAAAGAGGAATGTTGGGTGG + Intronic
952880452 3:37982591-37982613 CAGACCAAAGTGCTGTTGGGAGG - Exonic
953077464 3:39583232-39583254 CTCACACAAAGGCTGTTTGGTGG - Intergenic
957073076 3:75580713-75580735 CTCAAAAAAGGTCTGTTGGTAGG - Intergenic
957729523 3:84115509-84115531 CTCACACAAAGGCTGTTTGGTGG - Intergenic
958258219 3:91349243-91349265 CTGCCACAAGGGGTGCTGGGAGG - Intergenic
958787840 3:98617710-98617732 CTGAGAAAAGGGCTGTGTGCAGG + Intergenic
959688758 3:109176425-109176447 CTCACACAAAGCCTGTTGGGTGG - Intergenic
963520955 3:146359418-146359440 CTCACAGAAGGCCTGTTTGGTGG + Intergenic
965104754 3:164342204-164342226 CTCACACAAAGCCTGTTGGGTGG - Intergenic
966691137 3:182742754-182742776 CTCACAAAAAGCCTGTTTGGTGG - Intergenic
971042307 4:22767367-22767389 CTGCCAAAGATGCTGTTGGGAGG + Intergenic
971272701 4:25165632-25165654 TTGCCAAAATGGCTGGTGGGAGG - Intronic
976665207 4:87583316-87583338 CTGAAAAAAGGACTATTGGATGG - Intergenic
977286661 4:95116351-95116373 CAAACAAAAGGTCTCTTGGGAGG - Intronic
980349633 4:131668795-131668817 CTCACAAAAAGCCTGTTTGGTGG + Intergenic
980785264 4:137545422-137545444 CTGACACTAGGCCTGTTGCGTGG + Intergenic
981194614 4:141903919-141903941 CTCAGAAAAGGGCTTTTGAGGGG - Intergenic
981539378 4:145832964-145832986 CTCACACAAGGCCTGTTTGGTGG + Intronic
982093800 4:151902449-151902471 CTCACACAAAGGCTGTTTGGTGG - Intergenic
983882214 4:172945914-172945936 ATGATAAAAGGGCTGTGGGGTGG + Intronic
985658327 5:1143351-1143373 CAGACCAAGGGGCTGCTGGGCGG + Intergenic
986368082 5:7055030-7055052 CTGACACAAAGCCTGTTTGGTGG - Intergenic
990457094 5:55998458-55998480 TTGATAAAAGGGTTCTTGGGGGG - Intergenic
993396046 5:87390223-87390245 CTGACATAAGGGCTACTGAGAGG + Intronic
994314490 5:98316556-98316578 CATACAAAAGGGCTGGTGGGGGG + Intergenic
995804546 5:116036985-116037007 CTGAGAAAAGGGCTGCTCAGAGG - Intronic
997671978 5:135682655-135682677 GAGAAAAAAGGGCTGCTGGGTGG + Intergenic
1001330973 5:170762104-170762126 CTCACAAAAAGCCTGTTTGGTGG - Intergenic
1001353686 5:171000602-171000624 CTCACACAAAGGCTGTTTGGTGG - Intronic
1002611457 5:180421328-180421350 CTGACACAAAGCCTGTTTGGTGG - Intergenic
1005110367 6:22274808-22274830 CTGAAAAACGAACTGTTGGGTGG - Intergenic
1006711494 6:36076345-36076367 CTGACTAAAGGGCTGTTCAAAGG - Intronic
1007808927 6:44472747-44472769 CCAACAAAAGCGCCGTTGGGTGG + Intergenic
1008905206 6:56669790-56669812 ATGACAATAGGGATGTTGTGAGG + Intronic
1011173909 6:84539300-84539322 CAGCCAAATGGGCTGTTGGGTGG - Intergenic
1011354382 6:86458805-86458827 CTCACAAAAAGCCTGTTTGGCGG + Intergenic
1011367377 6:86598275-86598297 CTCACACAAAGGCTGTTTGGTGG - Intergenic
1015025939 6:128532550-128532572 CTGACAACAGGGATGTAGGATGG - Intergenic
1015712276 6:136155317-136155339 TTGGCAACAGTGCTGTTGGGTGG - Intronic
1015800750 6:137060310-137060332 CTCACAAAAAGCCTGTTTGGTGG - Intergenic
1017178314 6:151525719-151525741 CTCACACAAAGCCTGTTGGGTGG + Intronic
1017242595 6:152187496-152187518 CTGAGGAAGGGGCTGTTGAGAGG - Intronic
1020073040 7:5240116-5240138 CTGACAACAGCGCTCTGGGGAGG - Intergenic
1023411315 7:39891669-39891691 CTTCCAAAAGGGCTGATGGCAGG + Intergenic
1023640309 7:42250719-42250741 GTGCCAAAAGGGCAGCTGGGTGG + Intergenic
1026533432 7:71220303-71220325 CTTTCAAAAGGCCAGTTGGGAGG + Intronic
1027343641 7:77235672-77235694 CTGGCAGAAGGGCAGTTAGGAGG + Intronic
1028670990 7:93399580-93399602 CTGACAAAAAGCCTGTTTGGTGG + Intergenic
1029958115 7:104660767-104660789 ATGCCTAAAGGGCTGTTGTGAGG - Intronic
1030441162 7:109591844-109591866 CTCACACAAGGCCTGTTTGGTGG - Intergenic
1030441962 7:109597212-109597234 CTCACACAAAGCCTGTTGGGTGG - Intergenic
1030701040 7:112641261-112641283 CACACACCAGGGCTGTTGGGGGG - Intergenic
1031399622 7:121315772-121315794 CTCACACAAAGGCTGTTTGGTGG + Intergenic
1033161228 7:138998868-138998890 CTAGCAAGAGGGCTGTGGGGAGG - Intergenic
1036308208 8:7617064-7617086 CTCAAAAAAGGTCTGTTGGTAGG + Intergenic
1036359065 8:8065065-8065087 CTCAAAAAAGGTCTGTTGGTAGG + Intergenic
1036416337 8:8552838-8552860 CTGACAAAAGGTGTGTAAGGTGG - Intergenic
1036891893 8:12601887-12601909 CTCAAAAAAGGTCTGTTGGTAGG - Intergenic
1039743950 8:40406966-40406988 CTGTCTAAAGGGATGTTGGCAGG - Intergenic
1039949693 8:42159865-42159887 ATTACAAAGGGGTTGTTGGGAGG + Intronic
1044131166 8:88525900-88525922 CTGTCAAAATCCCTGTTGGGAGG - Intergenic
1045739323 8:105336264-105336286 CTTATATAAGGGCTGTTGAGAGG + Intronic
1046038789 8:108877409-108877431 CTGACAAGAAGTCTGTTGTGAGG + Intergenic
1046550558 8:115710325-115710347 CTCACAAAAAGCCTGTTTGGTGG + Intronic
1047732353 8:127737650-127737672 CTGGCAAAAGGAGTGTTGGACGG + Intronic
1048296552 8:133218947-133218969 CTGACAGAGGGGCTGTGCGGGGG - Intronic
1049447000 8:142635761-142635783 CTGCGAAAGGGGCTGTTGTGGGG + Intergenic
1050223221 9:3420467-3420489 CTCTTAAAAGGGCTGTTGTGGGG - Intronic
1052192397 9:25675172-25675194 CTCACACAAAGCCTGTTGGGTGG + Intergenic
1052192520 9:25676339-25676361 CTCACAAAAAGCCTGTTTGGTGG + Intergenic
1055086722 9:72321789-72321811 CTGACAAATGTGTTGTTAGGTGG - Intergenic
1055882288 9:81015236-81015258 CTGACACAAAGCCTGTTTGGTGG + Intergenic
1056363160 9:85879256-85879278 CTGACACAAAGCCTGTTTGGTGG - Intergenic
1056493870 9:87136430-87136452 CTGATAAGAGGGAGGTTGGGGGG + Intergenic
1057802455 9:98198572-98198594 CTGAAAAATGGGTGGTTGGGAGG - Intergenic
1058184127 9:101833902-101833924 CTGACAAAAGAGCTATTGAGAGG + Intergenic
1059302732 9:113328148-113328170 CTAAATAAAGGGCTGTTGGGAGG + Intronic
1059345503 9:113625367-113625389 CTCCCCAAAGGGCTGTTGGGTGG - Intergenic
1061238036 9:129353268-129353290 CTGATGAAGGGGCTGGTGGGAGG + Intergenic
1185536353 X:864524-864546 CACACAAAAAGGCTGTGGGGAGG - Intergenic
1187103281 X:16216898-16216920 CTAACACAAAGGCTGTTTGGTGG - Intergenic
1187104020 X:16221897-16221919 CTCACACAAAGGCTGTTTGGTGG - Intergenic
1189202905 X:39213076-39213098 ATGACAAAAGGGCTCTGGGATGG - Intergenic
1195908284 X:109866099-109866121 CTCACACAAAGGCTGTTTGGTGG - Intergenic
1197620591 X:128743369-128743391 CAGACACAAGGGCTGGTGGTTGG - Intergenic
1199343456 X:146709495-146709517 CTGTCACAAGGGCTGTTTGCTGG + Intergenic
1199377498 X:147131695-147131717 CTCACACAAAGCCTGTTGGGTGG - Intergenic
1199431957 X:147771882-147771904 CTGACAAAATGGTTGTTTGGGGG + Intergenic
1200337154 X:155362626-155362648 CTGAAAACAGGGGTGTTGAGTGG + Intergenic
1200349316 X:155478601-155478623 CTGAAAACAGGGGTGTTGAGTGG - Intergenic
1200971604 Y:9158484-9158506 CTGATGAAATGGCTGTTGGAGGG + Intergenic
1201945475 Y:19505256-19505278 CTGGCAAGACTGCTGTTGGGTGG - Intergenic
1202139414 Y:21705813-21705835 CTGATGAAATGGCTGTTGGAGGG - Intergenic