ID: 1179520754

View in Genome Browser
Species Human (GRCh38)
Location 21:41942830-41942852
Sequence CTGGAAATGAACCCGCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179520738_1179520754 30 Left 1179520738 21:41942777-41942799 CCCCAGGGGCTGGCCTCTCCCTG 0: 1
1: 1
2: 11
3: 89
4: 620
Right 1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1179520741_1179520754 28 Left 1179520741 21:41942779-41942801 CCAGGGGCTGGCCTCTCCCTGGG 0: 1
1: 0
2: 7
3: 73
4: 621
Right 1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1179520751_1179520754 -9 Left 1179520751 21:41942816-41942838 CCAAGATTCCTTGGCTGGAAATG 0: 1
1: 0
2: 1
3: 43
4: 311
Right 1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1179520744_1179520754 17 Left 1179520744 21:41942790-41942812 CCTCTCCCTGGGATCTGAGAGGG 0: 1
1: 0
2: 1
3: 26
4: 305
Right 1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1179520739_1179520754 29 Left 1179520739 21:41942778-41942800 CCCAGGGGCTGGCCTCTCCCTGG 0: 1
1: 1
2: 5
3: 55
4: 458
Right 1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1179520748_1179520754 11 Left 1179520748 21:41942796-41942818 CCTGGGATCTGAGAGGGTGGCCA 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1179520747_1179520754 12 Left 1179520747 21:41942795-41942817 CCCTGGGATCTGAGAGGGTGGCC 0: 1
1: 0
2: 0
3: 16
4: 177
Right 1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179520754 Original CRISPR CTGGAAATGAACCCGCCTGG TGG Intronic
908273307 1:62442365-62442387 CTGGAAATGAAGAGGACTGGGGG + Intronic
919878913 1:201889392-201889414 CTGGGGATGAACTGGCCTGGTGG + Intronic
922994436 1:229944590-229944612 CTGGAGAGGATCCAGCCTGGGGG - Intergenic
923008502 1:230070413-230070435 CTGGAAATGAAGCTGCCTGTGGG + Intronic
1063155536 10:3375877-3375899 CAGAATATGAACCAGCCTGGAGG - Intergenic
1071912291 10:90250101-90250123 CTGGAAAAGAACATGCCTGGTGG - Intergenic
1072043538 10:91632847-91632869 CTGGAAATGGACACCCCAGGGGG - Intronic
1075563535 10:123486365-123486387 CTTGAAATGATCCTGCCTTGGGG + Intergenic
1079101191 11:17543420-17543442 CTGGGGATGAAGCCGCTTGGGGG - Intronic
1080047707 11:27826815-27826837 CTGGATAGGAACCTGTCTGGAGG + Intergenic
1082568078 11:54704811-54704833 CTGGAAGTGAAACCTCCTGTCGG - Intergenic
1084316424 11:68348350-68348372 CTGAAAATGAACCCGTGGGGGGG + Intronic
1089395837 11:118135992-118136014 TGGGAAATGAACCACCCTGGGGG + Exonic
1089533196 11:119145193-119145215 CTGGAAAGGAATTCGACTGGGGG - Intergenic
1091697240 12:2636145-2636167 CTGGAAAGGAAACCTCCTGAGGG - Intronic
1092079996 12:5708048-5708070 CTGGAAAAGAAGCAGCCTGGGGG - Intronic
1092123812 12:6062404-6062426 CTGGAAATGACCCTGGCAGGTGG - Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104900715 12:132188303-132188325 CTGGGGAAGAACCCGCCTGCAGG - Intergenic
1106304515 13:28497554-28497576 ATGGAATTCAACACGCCTGGTGG + Intergenic
1107530401 13:41277489-41277511 CTGGAAATGTAACCACCTGATGG - Intergenic
1112440285 13:99420111-99420133 TTGTAACTGAACCCACCTGGAGG - Intergenic
1122375616 14:101255092-101255114 ATGGAATTCATCCCGCCTGGGGG - Intergenic
1128260749 15:66231302-66231324 CTGCAGATGAACCCCCCTGAGGG + Intronic
1130664058 15:85854343-85854365 GTGGGAAGGAACCAGCCTGGAGG + Intergenic
1131582454 15:93658084-93658106 CTTGAAATGAACCCAGCTGAGGG + Intergenic
1132585511 16:704469-704491 CTGGACCTGGAGCCGCCTGGAGG - Intronic
1133139725 16:3735118-3735140 CTGGAAGAGGACCCGCCAGGCGG - Intronic
1148088865 17:45010614-45010636 CTGGAAATGGAAGCCCCTGGAGG - Intergenic
1149584511 17:57776579-57776601 GTGGAAATGAAGCCAGCTGGCGG - Intergenic
1151763875 17:76122222-76122244 CCGGGAAAGATCCCGCCTGGCGG - Intergenic
1163096102 19:15058209-15058231 CTGGAAATGACCACTTCTGGAGG + Exonic
1166220809 19:41363403-41363425 GTGGAAATGAACCAGGCTTGGGG + Intronic
934699622 2:96429171-96429193 CTGGAAATGAAGCTTCCTTGAGG + Intergenic
936227380 2:110669110-110669132 CTGGGAATGGATCCACCTGGGGG - Intronic
940305729 2:152224206-152224228 CTGGAAAGGAAAGAGCCTGGTGG - Intergenic
941249351 2:163143666-163143688 CTGGAATTCAACCTGCCGGGTGG + Intergenic
945100355 2:206257446-206257468 CTGGAAGCGAACCCTCCTGCCGG - Intergenic
1171182921 20:23104154-23104176 CTGCAAAGCAACCTGCCTGGAGG - Intergenic
1175332093 20:58172198-58172220 CTGGAAATGCTTCAGCCTGGAGG + Intergenic
1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG + Intronic
1180119522 21:45737532-45737554 CTGGAAATAAACCAGCGTGCTGG + Intronic
1182583145 22:31327351-31327373 CTGGAGATGCCCCCTCCTGGAGG + Intronic
1182706569 22:32284890-32284912 CTGGAAGAAAACCCTCCTGGGGG - Intergenic
1184334233 22:43844015-43844037 CTGGAATTGAACTGGACTGGGGG + Intronic
1184361235 22:44020086-44020108 CTGGAATTGAACTGGACTGGGGG - Intronic
949963483 3:9334959-9334981 CTGGAAATGTACCTGCCTACAGG + Intronic
953646580 3:44761336-44761358 CTTGAAAAGAACCAGCCTGGGGG + Intronic
954213025 3:49108945-49108967 CTGGAGATGAGCTCGCCTGCAGG - Exonic
955240655 3:57174997-57175019 CAGTAAATGAGACCGCCTGGAGG - Intergenic
955528269 3:59843358-59843380 CTGGAAAAGAACAAACCTGGAGG - Intronic
962455906 3:135565419-135565441 CTGGAAAGGAAGCTGCTTGGTGG - Intergenic
967917128 3:194587099-194587121 CTGAAAAGGAACCAGACTGGAGG - Intergenic
975973817 4:80072939-80072961 CTGGAACCCACCCCGCCTGGAGG + Intronic
976550338 4:86387151-86387173 CTGGAAATGAAGCAGCCGGAGGG + Intronic
982297633 4:153846317-153846339 GTGGAAATGAATCCACCAGGAGG + Intergenic
992950118 5:81850457-81850479 CTGAAAGTGGACCTGCCTGGTGG + Intergenic
1001147411 5:169196852-169196874 CTGGAAAGGAACTCTCTTGGAGG + Intronic
1001328826 5:170747993-170748015 CTGGAACTAAAGCCCCCTGGTGG - Intergenic
1006291796 6:33143433-33143455 CTGGAGATGAAACAGCCTGATGG + Intergenic
1018808256 6:167277930-167277952 CAGGACAGGAGCCCGCCTGGTGG - Intronic
1021007512 7:15417239-15417261 GTGGAAATGAAGCCACTTGGAGG + Intronic
1028897247 7:96055824-96055846 CTGGAAATGCACCAGCTTTGTGG + Intronic
1032863031 7:135899462-135899484 ATAGGAATGAACACGCCTGGAGG - Intergenic
1033238336 7:139656177-139656199 CTGGGAATGCATCTGCCTGGTGG - Intronic
1033431448 7:141293227-141293249 CTAGAAAAGGACCCACCTGGGGG + Intronic
1034562224 7:151888287-151888309 TTGGAAATCACCCCACCTGGCGG - Intergenic
1044396843 8:91722524-91722546 CTGAAAATGTAACCGCCTGACGG - Intergenic
1046572169 8:115979778-115979800 CTGGAAATGCACTGGCCAGGAGG - Intergenic
1051196056 9:14563912-14563934 CTGCAGATGAACCAGCTTGGTGG - Intergenic
1054453138 9:65413847-65413869 CTGGAGATGACACCTCCTGGTGG + Intergenic
1057136074 9:92688780-92688802 CTGGGGATGAACATGCCTGGTGG + Intergenic
1057209262 9:93190842-93190864 CTGGAAAAGCAGCCGCCTAGAGG - Intronic
1057558372 9:96107744-96107766 CTGGGAAGGAACCCTTCTGGGGG - Exonic
1061852148 9:133422542-133422564 CTGCAAATGAGCCCACCTGCTGG - Exonic
1062369238 9:136228679-136228701 CAGCAAATGGACCTGCCTGGAGG + Intronic
1199822426 X:151462550-151462572 CTGGAATTGAAGCAGCCTGAGGG - Intergenic
1199971533 X:152865373-152865395 CTGGAACAGACCCGGCCTGGTGG + Intronic