ID: 1179521120

View in Genome Browser
Species Human (GRCh38)
Location 21:41945649-41945671
Sequence CCTCACCTGCAGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 711
Summary {0: 1, 1: 1, 2: 7, 3: 88, 4: 614}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179521112_1179521120 7 Left 1179521112 21:41945619-41945641 CCACCATGTGTCAAGAGAGGGAC 0: 2
1: 11
2: 30
3: 74
4: 223
Right 1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG 0: 1
1: 1
2: 7
3: 88
4: 614
1179521113_1179521120 4 Left 1179521113 21:41945622-41945644 CCATGTGTCAAGAGAGGGACCTG 0: 7
1: 126
2: 628
3: 1843
4: 4271
Right 1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG 0: 1
1: 1
2: 7
3: 88
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179521120 Original CRISPR CCTCACCTGCAGAGGGAGGG AGG Intronic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900359159 1:2279564-2279586 CTCCAGCTGCAGGGGGAGGGGGG + Intronic
900673470 1:3869903-3869925 CCTCACATTCCCAGGGAGGGCGG + Intronic
901044235 1:6385950-6385972 CCTCTCCCGCAGAGGGGTGGTGG - Intronic
901231512 1:7644152-7644174 CCTCACCTGCTGTGAGATGGGGG + Intronic
901422162 1:9158487-9158509 ACTGCCCTGCAGAGGGAGAGAGG - Intergenic
901437654 1:9257836-9257858 CCTCACCTACAGAGAGAGCCTGG - Intronic
901452446 1:9344393-9344415 CCTCACCGCCAGACAGAGGGAGG + Intronic
901787480 1:11634326-11634348 CCAAACCTGGAGAGGGAGGCAGG + Intergenic
901865847 1:12106272-12106294 CAGCACGTGCAGAGGGCGGGTGG - Intronic
902251463 1:15156342-15156364 CCAGGCCTGCAGAGGGAGGGAGG - Intronic
902863626 1:19262971-19262993 CCTCACCTGCTCAGTGAGGAAGG + Intergenic
903358352 1:22761888-22761910 GCTCCCCAGCAGAGGGAGGGGGG + Intronic
903451908 1:23459399-23459421 GCCCACCTCCAGAGGAAGGGAGG - Intronic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
904004592 1:27357109-27357131 CTTCACCTGCAGGGGGAGGGAGG + Exonic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904294203 1:29507209-29507231 CACCACCTGCAGAGGGTGAGGGG - Intergenic
904684394 1:32250109-32250131 CCTCAGCTGCAGAGAGAAGTGGG - Intergenic
904807762 1:33143686-33143708 CCTCACCCACAGAATGAGGGAGG - Intergenic
904820002 1:33235879-33235901 CCTGACCAACAGAAGGAGGGAGG - Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905920183 1:41714117-41714139 GCTCACCAGCTCAGGGAGGGAGG + Intronic
906289479 1:44610489-44610511 CCTGACCTCCTGAGGGAGCGAGG + Intronic
906504754 1:46370472-46370494 GCCTACCTGCAGAGGGAGTGGGG - Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907912692 1:58840699-58840721 CCTCACCTGAAGAATGATGGGGG + Intergenic
908131476 1:61080012-61080034 CCTCCCCCGCGGAGGGAGGGGGG - Intronic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
908776874 1:67649100-67649122 CCTCAACCTAAGAGGGAGGGTGG - Intergenic
908855609 1:68423587-68423609 CCCCACATGTTGAGGGAGGGTGG + Intergenic
910010503 1:82455447-82455469 TGTCACCTGCAGAGAGAGGCTGG + Intergenic
910797643 1:91115063-91115085 CCCCACATGTTGAGGGAGGGAGG - Intergenic
911146178 1:94554621-94554643 CCCCATCTGGACAGGGAGGGAGG - Intergenic
912227131 1:107746658-107746680 CCGCACCTGCCGAGGGAGGCTGG - Intronic
912583186 1:110738125-110738147 CCTCACCTGCAGGAGATGGGAGG - Intergenic
913172134 1:116242735-116242757 CACCACCTTCAGAGGGAGGCTGG - Intergenic
913370152 1:118089828-118089850 CCCCACGTGTCGAGGGAGGGAGG + Intronic
915917013 1:159946205-159946227 CCTCAGCTGCACACGGTGGGAGG - Intergenic
915971457 1:160358132-160358154 GATCAACTGCAGGGGGAGGGAGG - Exonic
916215128 1:162387380-162387402 GCTCACCTGCGGAGAGAAGGTGG + Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917802993 1:178587238-178587260 CCAGAGCTGCAGAGAGAGGGGGG - Intergenic
919319750 1:196020936-196020958 TCTCTCCTGCAGAGAGAGAGGGG + Intergenic
919535988 1:198788583-198788605 CCTCAGCTACAGAGAGAGGTAGG - Intergenic
921184098 1:212655520-212655542 GATGGCCTGCAGAGGGAGGGAGG + Intergenic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
921552327 1:216553184-216553206 CCTGGGCTGCAGAGGGAGAGAGG - Intronic
922335988 1:224618234-224618256 CCTCACCCTCAGAGGGCTGGTGG + Intronic
922371234 1:224912163-224912185 CCTCACCTGAAAAGAAAGGGAGG - Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
1063056240 10:2507453-2507475 CCTCCCCTTCAGAGGGATGATGG - Intergenic
1063223713 10:3994498-3994520 CCTTACCTGTAGAAGGAAGGAGG + Intergenic
1063427617 10:5962205-5962227 AGTCACCTGCACAGGGAGGAAGG - Intronic
1063438999 10:6056906-6056928 CCTGCCCTGGACAGGGAGGGCGG - Intronic
1063439314 10:6059650-6059672 CCTGCCCTGGACAGGGAGGGTGG - Intronic
1064215911 10:13400572-13400594 TCTCTCCTGCAGAGAGAGAGGGG + Intergenic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1065607427 10:27432640-27432662 ACTCACATGGAGAGGGAGGGAGG - Intergenic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1067511364 10:46897564-46897586 CCTCCCCTGCAGACAGAGGATGG + Intergenic
1067650883 10:48154298-48154320 CCTCCCCTGCAGACAGAGGATGG - Intergenic
1067838228 10:49654670-49654692 CATGACCTCCAGAGGGAGGCAGG - Intronic
1070312124 10:75281556-75281578 CCCCAGCTGCAGATGGAGGTGGG + Intergenic
1070766373 10:79058760-79058782 CCTGACCTGCAGGGTGGGGGTGG - Intergenic
1071840191 10:89462438-89462460 CCTCCCCTCCAGATGGAGGCTGG - Exonic
1073076008 10:100826339-100826361 TTTCTCCCGCAGAGGGAGGGAGG + Intronic
1073116926 10:101096499-101096521 CATCACCTACTGAGGCAGGGCGG + Intronic
1074039285 10:109772213-109772235 CCTCATCTGAGGAGGCAGGGAGG - Intergenic
1074052083 10:109889056-109889078 CCTCATCTGCAAGGGCAGGGTGG + Intronic
1074149025 10:110741814-110741836 GCTCTCCTGGGGAGGGAGGGGGG - Intronic
1074633845 10:115290714-115290736 TCTCTCCTGCAGAGAGAGAGGGG + Intronic
1074686445 10:115966364-115966386 CCCCACGTGTTGAGGGAGGGAGG + Intergenic
1075097641 10:119483052-119483074 CCTCACGTGTGGAGGGAGGGAGG + Intergenic
1075444998 10:122506891-122506913 CCCCACCCGCAGAGGGACAGAGG - Intronic
1075462922 10:122630739-122630761 CCTCACCTCCAGACGGAGAGGGG - Intronic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075656226 10:124162970-124162992 ACTCTGCTGCGGAGGGAGGGAGG + Intergenic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076065425 10:127444363-127444385 CCTCTGCTGCAAGGGGAGGGAGG - Intronic
1076183863 10:128431471-128431493 CTCCACCTGCCGAGGGAGGTCGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076437978 10:130459547-130459569 CCTAAGGTGAAGAGGGAGGGGGG + Intergenic
1076438039 10:130459806-130459828 CCTAAGGTGAAGAGGGAGGGGGG + Intergenic
1076452252 10:130564921-130564943 CCCCAAATGCAGAGGCAGGGAGG - Intergenic
1076741572 10:132488299-132488321 CCCCACCTGCGGAGGACGGGGGG + Intergenic
1077093440 11:789623-789645 CCAGACCTGCAGAGAAAGGGAGG + Intronic
1078424058 11:11235024-11235046 CCTCACATGCAGGGTGAGGTTGG - Intergenic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079501395 11:21105258-21105280 TCTCTCCTGCAGAGAGAGAGAGG + Intronic
1080804431 11:35639600-35639622 CCTCACTGGCAGGGGTAGGGTGG - Intergenic
1080853492 11:36091490-36091512 TCTCTCTGGCAGAGGGAGGGAGG - Intronic
1080937871 11:36882500-36882522 CCCCTCCTGCAAAGGGAGGCAGG + Intergenic
1081549800 11:44100654-44100676 CATCTCCTGCAGCTGGAGGGTGG + Intronic
1082794841 11:57371454-57371476 GCTCAACTGTAGATGGAGGGCGG + Intergenic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083140073 11:60714473-60714495 CCCCACATTCAGAGGGATGGTGG + Intronic
1083625987 11:64072207-64072229 CCTCAGCTGCTGTGGGATGGAGG + Intronic
1084419937 11:69055336-69055358 CCTCACCTTCACAGAGAGGTCGG - Exonic
1084453978 11:69256820-69256842 CCACCAGTGCAGAGGGAGGGAGG + Intergenic
1084640603 11:70423702-70423724 GCCTAGCTGCAGAGGGAGGGTGG + Intronic
1084778359 11:71392286-71392308 CCTCAGCTGCCGAGGGAAAGAGG - Intergenic
1084938800 11:72601386-72601408 CCTCACATGCTGGGGGAAGGAGG - Intronic
1085221234 11:74875342-74875364 ACTCCCCTGCAGAGGCAGAGTGG + Intronic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1085793015 11:79512351-79512373 TCACAGCTGTAGAGGGAGGGAGG + Intergenic
1086052792 11:82613702-82613724 GCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1086161053 11:83722543-83722565 CCTCACCTCCAGAGGCGGGGTGG + Intronic
1086407818 11:86514010-86514032 CCCCACATGCAGAGAGAGGGAGG + Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086938457 11:92769566-92769588 CTTTACCTGCAGATGGATGGGGG + Intronic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1089075439 11:115734750-115734772 CTTCCCCTGCAGAGGAAGGAAGG - Intergenic
1089304662 11:117518823-117518845 CCTCCCCTGCTGAGGTGGGGTGG - Intronic
1089354632 11:117841683-117841705 CCTCTCCTGGAGAGGAAAGGAGG - Intronic
1089356673 11:117858407-117858429 CCTGACATGGAGAGGGAGTGAGG - Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089654678 11:119938442-119938464 CCCAACATGGAGAGGGAGGGAGG - Intergenic
1090226036 11:125072897-125072919 CCTGGCCTCCAGAGGGATGGAGG - Intronic
1090425258 11:126603057-126603079 CCTCCCCTGCAGGGTGACGGTGG - Intronic
1094236858 12:28177899-28177921 CCCCACGTGTTGAGGGAGGGAGG + Intronic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1096979402 12:55719643-55719665 CCTCACCCGCAGGGGGAAGGAGG + Intronic
1097250112 12:57627853-57627875 CCCCACCTGCAGGGAGAGGGAGG + Exonic
1097271864 12:57780435-57780457 CCCCAGCAGCAGAGGGAAGGTGG - Exonic
1098032078 12:66265485-66265507 CCTGACCTGGAGAGGTGGGGAGG - Intergenic
1098772303 12:74568002-74568024 CCCCAGCTCCAGGGGGAGGGAGG + Intergenic
1100717850 12:97324653-97324675 CGTCCTCTGCACAGGGAGGGAGG + Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101659980 12:106757243-106757265 GCTCAGCAGCAGAGGGATGGTGG + Intronic
1101815898 12:108146012-108146034 CCTCGACTGGAGAAGGAGGGGGG + Intronic
1102101262 12:110280948-110280970 ACCCACCTGCAGACGCAGGGTGG - Intronic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1103139240 12:118534376-118534398 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
1103415339 12:120739059-120739081 CCTCCCCTGCTGAGGGAGTGGGG + Intronic
1103437237 12:120936440-120936462 CGGCACTTGCAGAGGGAGGGAGG - Intergenic
1103919087 12:124390149-124390171 CCTCCCCTGCAGAGGGCAGAGGG - Intronic
1103920427 12:124396596-124396618 CCTGACCTGCAGCGGCAGGCAGG + Intronic
1104279069 12:127357170-127357192 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
1104295242 12:127505858-127505880 CATCACCTGGGGGGGGAGGGAGG - Intergenic
1104346561 12:128004956-128004978 TCTCTCCTGCAGACGGAGAGGGG + Intergenic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1104936156 12:132365448-132365470 CCACTCCTGGAGAGGGAGGAAGG + Intergenic
1104946403 12:132416756-132416778 CCTCATCCCTAGAGGGAGGGGGG + Intergenic
1105645254 13:22311365-22311387 CCTAGCCTGCAGAAGGAGCGTGG + Intergenic
1105706167 13:22968781-22968803 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
1106546707 13:30737173-30737195 CCCCAACTGCACAGGCAGGGAGG - Intronic
1106589874 13:31089947-31089969 CCTCACCTGCAGAGGAATCAAGG - Intergenic
1106789792 13:33143017-33143039 CCTCACATGCAGAGAGAGAGAGG - Intronic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1109024638 13:57142531-57142553 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109025625 13:57149101-57149123 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109026615 13:57155674-57155696 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109027607 13:57162245-57162267 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109028593 13:57168810-57168832 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1110356681 13:74575454-74575476 CCTCACCTGCAAAACAAGGGTGG + Intergenic
1111180193 13:84653697-84653719 CCCCACGTGTGGAGGGAGGGAGG + Intergenic
1112188340 13:97149865-97149887 ACTCCCCTGCAGAGAGAGGAGGG - Intergenic
1112257898 13:97851408-97851430 CCCCACGTGTGGAGGGAGGGAGG - Intergenic
1113252872 13:108473154-108473176 CCCCACATGTAGAGGGATGGAGG + Intergenic
1113759373 13:112836995-112837017 CGTGACCTGCTGAGGGTGGGGGG - Intronic
1113868322 13:113543315-113543337 AGTCACCCACAGAGGGAGGGCGG - Intronic
1115875243 14:37853992-37854014 CCCCACGTGCTGAGGGAGGGAGG + Intronic
1117976389 14:61301062-61301084 TCTCTCCTGCAGAGAGAGCGGGG - Intronic
1119205298 14:72789430-72789452 CCTCTCCTACAGAGGCAGCGTGG - Intronic
1119940337 14:78633952-78633974 CTTCCCCTGCAGGGGGAGGGAGG - Intronic
1120142124 14:80941372-80941394 ACACCCCTGCCGAGGGAGGGAGG + Intronic
1120789727 14:88568594-88568616 CCCCACCTGTCAAGGGAGGGAGG - Intronic
1121015945 14:90549223-90549245 CTTCTCCTCCAGAGGGAGTGAGG + Intronic
1121021367 14:90582213-90582235 CCTCAGAGGCAGAGAGAGGGGGG - Intronic
1121368685 14:93337542-93337564 CAGCACCTGCAGAGGGCAGGAGG - Intronic
1121374858 14:93399200-93399222 CCCCACATGTAGAGGGAGGGAGG - Intronic
1121605515 14:95237313-95237335 CGGCACCTGCAGAGGCTGGGAGG + Intronic
1122486835 14:102087379-102087401 CCCCACCTGCCGCGGGCGGGCGG + Intronic
1122599852 14:102915767-102915789 CGTCACCTGCAGAGCAAGGGTGG - Intergenic
1122790640 14:104182849-104182871 GCTCACCTGCAGGGGATGGGTGG + Intergenic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1124511821 15:30334186-30334208 CCCCACGTGTCGAGGGAGGGAGG + Intergenic
1124731093 15:32196571-32196593 CCCCACGTGTCGAGGGAGGGAGG - Intergenic
1125464774 15:39940203-39940225 CATCACCTTCAGAGGGAGTCTGG - Intronic
1125931854 15:43605775-43605797 CTTCACAAGCAGAGGAAGGGTGG - Intronic
1125944953 15:43705253-43705275 CTTCACAAGCAGAGGAAGGGTGG - Intergenic
1125967678 15:43887356-43887378 CCTCACAGGCAAAGGGAGGGTGG + Intronic
1126694241 15:51312849-51312871 CCTCACAAGCAGCTGGAGGGAGG - Intronic
1126885985 15:53150557-53150579 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128028861 15:64461538-64461560 CCTCAACCCCAGAGGGAGGAAGG - Intronic
1128090472 15:64915635-64915657 CCTGACCTTGAGAGGGAGGAGGG + Intronic
1128114380 15:65096133-65096155 CTTCACCTTCAGAAGGAGGGCGG + Intronic
1128168022 15:65484581-65484603 TCTCTCCTGCAGAGAGAGAGAGG - Intronic
1128934704 15:71735310-71735332 CCACCCCTGCAGCGGGAGAGGGG - Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1129110799 15:73335946-73335968 CCTGACCCCCATAGGGAGGGGGG - Intronic
1129116638 15:73368531-73368553 CCTGAACGCCAGAGGGAGGGAGG - Exonic
1129161721 15:73751596-73751618 TGACACCTGCAGAGGGATGGTGG + Exonic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130086736 15:80783999-80784021 ACTCACCTGCAGGGGTGGGGAGG - Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1131441994 15:92466543-92466565 ACTCCCCTGCAAAGGGATGGTGG - Exonic
1131692997 15:94846405-94846427 CCTCACCTGCTGGGGTTGGGGGG - Intergenic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1131959485 15:97773562-97773584 CCTCACCTCAAGTGGAAGGGAGG + Intergenic
1132558431 16:582815-582837 CCCCGTCTGCAGAGAGAGGGTGG - Intronic
1133146470 16:3790796-3790818 CCTCGCCGCCAGAGGGAGGTGGG + Intronic
1134778459 16:16873390-16873412 CCTCTCCTGCAGAGGTGGGGCGG - Intergenic
1135289777 16:21225318-21225340 TCTCACGTGCTGAGGGAGGGAGG + Intergenic
1135380558 16:21992868-21992890 CCCCACCTGTGGAGGGAGGGAGG + Intronic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1136599090 16:31272097-31272119 CCCCACCGGCAGAGGTGGGGAGG + Intronic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1137290740 16:47050366-47050388 CCCCACCTGCTGGGGGAGGGAGG - Intergenic
1138239009 16:55411447-55411469 CCTCTCCTGCAGGGGAAGGACGG + Intronic
1138426014 16:56932429-56932451 CATCCCCAGCAGAGGGCGGGGGG - Intronic
1138778199 16:59750838-59750860 CCCCACGTGTAGAGGGAGGGAGG - Intronic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139659553 16:68411471-68411493 CCATGCCTGCAGTGGGAGGGTGG - Intronic
1139878232 16:70163592-70163614 ACAACCCTGCAGAGGGAGGGGGG - Intergenic
1140336284 16:74107956-74107978 CCCCACCAGCAGGGGGAGGTAGG - Intergenic
1140359331 16:74331220-74331242 ACAACCCTGCAGAGGGAGGGGGG + Intergenic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1140905737 16:79407474-79407496 ACACACATGCAGAGGGAGAGAGG - Intergenic
1141722641 16:85765317-85765339 CCTCAGCTGAGGATGGAGGGTGG + Intergenic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1142137067 16:88456294-88456316 TGTCACCTCCAGAGGGAGAGAGG + Intronic
1142231038 16:88900424-88900446 CCTCAGCGGCAGAGCCAGGGAGG + Intronic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1142969358 17:3600989-3601011 CTTCACCTGCAGATTCAGGGAGG - Intergenic
1143563567 17:7708813-7708835 CCAAAACTGAAGAGGGAGGGAGG - Intronic
1144523351 17:15969066-15969088 CCTCAGCTGCAGTGGAAGGAAGG - Intronic
1144575742 17:16428300-16428322 CCACAGCTGCGGAGGAAGGGAGG - Exonic
1144777468 17:17791979-17792001 CCTCACCTGCTGAGGTGGGGAGG + Intronic
1147703652 17:42411606-42411628 CCTCAGCTGCAGGGAGTGGGTGG + Intronic
1147976565 17:44251327-44251349 CTTCACCTGCAGGCGGAGGCTGG + Exonic
1148031817 17:44627323-44627345 CTTCACTTGCTGAGGGAGGAAGG + Intergenic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1148337115 17:46849435-46849457 CCTCACCTGCCTAGGGGGTGTGG + Intronic
1148564835 17:48626676-48626698 CCCTTCCTGCAGCGGGAGGGGGG - Intronic
1149077010 17:52607653-52607675 CCCCACATGTTGAGGGAGGGAGG + Intergenic
1149203833 17:54220012-54220034 CCTCACCTCTAAAGGGAGGGGGG - Intergenic
1149512884 17:57257130-57257152 CCTCACCAGGTAAGGGAGGGAGG + Exonic
1149774496 17:59346517-59346539 CCTTGCTTGGAGAGGGAGGGAGG + Intronic
1149815082 17:59715511-59715533 CCCCACATGTTGAGGGAGGGAGG - Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150249429 17:63698007-63698029 CTTGCCCTGCAGAGGCAGGGTGG + Exonic
1151124123 17:71826735-71826757 CCCCACCTGTGGAGAGAGGGAGG - Intergenic
1151215849 17:72575857-72575879 ACTCACTTGCAGAGGCAGGAGGG + Intergenic
1151353906 17:73547207-73547229 CCTGCCCTGCAGAGGGGGCGTGG - Intronic
1151656776 17:75499835-75499857 ACTCCCCCACAGAGGGAGGGAGG - Exonic
1151890821 17:76949501-76949523 CCTCAAGTGTAGAGGGAGGGTGG - Exonic
1151930931 17:77230813-77230835 CCCCACATGTGGAGGGAGGGAGG + Intergenic
1151933533 17:77247784-77247806 CCTCACATGGAGGGGGAGGGAGG - Intergenic
1151944701 17:77313189-77313211 CTGCCCCTGCAGAGCGAGGGAGG - Intronic
1151985426 17:77540332-77540354 CCTTACCTGCAGGGCCAGGGCGG + Intergenic
1152185886 17:78856078-78856100 GCACACCTGCAGTAGGAGGGGGG - Intronic
1152250606 17:79210722-79210744 CCAGACGTGCAGATGGAGGGTGG - Intronic
1152330616 17:79670504-79670526 CTTCACCTGCAGGGTGAAGGTGG + Intergenic
1152380699 17:79941102-79941124 CCTCGCCTGCAGACAGAGGACGG + Exonic
1152555377 17:81050305-81050327 CCTCTCTTGCAGATGGAGGCAGG + Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1154020238 18:10658266-10658288 TCTCTCCTGCAGAGAGAGAGAGG + Intergenic
1154497644 18:14974288-14974310 CTTCACCTCCACAGGCAGGGTGG + Intergenic
1155071403 18:22320135-22320157 CTGCACCTGCAGAGTGAGGCAGG + Intergenic
1155623068 18:27803251-27803273 CCCCACATGTAGAGGGAGGGAGG + Intergenic
1155856635 18:30842911-30842933 CCCCACCTGTCCAGGGAGGGAGG + Intergenic
1156513211 18:37659048-37659070 CCTCCACTGCAGAGGTAGAGAGG + Intergenic
1157296741 18:46450466-46450488 ACTCACCAGCAGAGGTGGGGAGG - Intronic
1157444771 18:47736493-47736515 CCTCACCTGCTGGGGATGGGAGG - Intergenic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157918752 18:51695110-51695132 TCTCTCCTGCAGAGAGAGAGGGG + Intergenic
1158396348 18:57081121-57081143 CTGCACCTGCAGAGGAAAGGGGG + Intergenic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1159537841 18:69737431-69737453 CCCCACATGTGGAGGGAGGGAGG - Intronic
1160279189 18:77471285-77471307 CTTCTCGTGCAGAGGGAGGGTGG + Intergenic
1160507735 18:79436811-79436833 CCTTTCCTTCAGAGGGAAGGAGG + Intronic
1161025253 19:2033831-2033853 CTGCAGCTGCAGTGGGAGGGAGG - Intronic
1161315241 19:3614584-3614606 GCTCACCTGCAGCGGGGTGGGGG + Exonic
1161503640 19:4632136-4632158 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
1161631045 19:5355659-5355681 CCTCTCCTGTACAGGGAGTGAGG - Intergenic
1162880190 19:13653146-13653168 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1163060641 19:14758916-14758938 CCTCTCCTGCAGAGAGACAGGGG + Intronic
1163384247 19:16989637-16989659 TCTTACCTGCAGTGGGTGGGAGG + Exonic
1163510882 19:17734256-17734278 GGTCACCTGCAGGTGGAGGGGGG - Exonic
1163790252 19:19302203-19302225 CCTCCCCTGCAGGGGGACTGTGG + Intronic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164763644 19:30746510-30746532 CCTCTCCTGCAGAGAGAGAGAGG + Intergenic
1165308337 19:35015760-35015782 CGTGGCCCGCAGAGGGAGGGAGG + Intronic
1165744443 19:38222459-38222481 CCAAACCTGGAGAGAGAGGGGGG + Exonic
1166071946 19:40393086-40393108 CCTCACCGGCAGAGGGCAGGTGG + Intergenic
1166765364 19:45249781-45249803 CCCCACCTGCAGAGAGCTGGGGG - Intronic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1166851616 19:45764104-45764126 CCGCACCTCCAGTGAGAGGGCGG + Exonic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1166937502 19:46343288-46343310 CATCACCTCCAGAGGGAGGAGGG - Exonic
1167116630 19:47492576-47492598 CCTCATCCACAGTGGGAGGGAGG - Intronic
1167162642 19:47778290-47778312 CCTCCCCTGGAGAGGGCGAGGGG - Intergenic
1167474053 19:49690089-49690111 CCTCGCCTGGAGAGGGAGCGTGG - Exonic
1167615649 19:50531431-50531453 ACCCAGCTGCAGAGGGAAGGGGG + Intronic
1168097610 19:54124482-54124504 CCACACCTGCGGTGGGAGGGAGG - Exonic
1168124996 19:54278117-54278139 ACTCACCCTCAGAGGGAAGGAGG - Intronic
1168176986 19:54633437-54633459 ACTCACCCTCAGAGGGAAGGAGG + Intronic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
925122708 2:1431885-1431907 TCTAACTTGCAGAGGGAAGGAGG + Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925542525 2:4980850-4980872 CCCCACGTGTGGAGGGAGGGAGG + Intergenic
925790119 2:7476107-7476129 CCTCACCTGCTGGGTGAAGGAGG - Intergenic
926166131 2:10522938-10522960 CATCACCTGCTGAGTGAAGGCGG + Intergenic
926312085 2:11682174-11682196 GCTCACCTGCAGGAGGAGTGGGG - Intronic
926695354 2:15766837-15766859 CCTCAACTGCAGAGGAGGGGAGG + Intergenic
927477925 2:23428284-23428306 CCTCACATGCAGGGGGACAGCGG - Intronic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
928399109 2:30965307-30965329 CCTCAGCTGCAGAGGTGAGGAGG - Intronic
928538331 2:32261249-32261271 TCTCTCCTGCAGAGAGAGAGGGG - Intronic
928679104 2:33680755-33680777 CCTCCACTGCAGGTGGAGGGTGG + Intergenic
929546214 2:42856644-42856666 CCTCAGATGCAGGGAGAGGGTGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930853832 2:55990825-55990847 CCACAACTGCACAGGGAGGTGGG + Intergenic
930872838 2:56184982-56185004 GGTCACCTGTTGAGGGAGGGAGG - Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932350293 2:71025714-71025736 CCTAACATCCAGAGGGAGAGAGG - Intergenic
932411706 2:71551464-71551486 CCTCACCTGCAGGGGGGATGAGG + Intronic
932621450 2:73266728-73266750 GCTCTCCTCCAGAGGGTGGGTGG - Intronic
934699253 2:96426019-96426041 CCCCACGTGTCGAGGGAGGGAGG - Intergenic
934904306 2:98185590-98185612 GCTCACCTGCAGAGAGTGAGTGG - Intronic
935235381 2:101134024-101134046 CCCCACATGTCGAGGGAGGGAGG - Intronic
935534984 2:104283569-104283591 GCTCAGGAGCAGAGGGAGGGGGG + Intergenic
936937247 2:117850207-117850229 CCCCTCCTGATGAGGGAGGGAGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937288226 2:120766384-120766406 CCCCACCTGTGGAGGGAAGGTGG + Intronic
937342369 2:121099448-121099470 CCTCACCTGCAGACGGAACAGGG - Intergenic
937344378 2:121115389-121115411 CGTCAGCAGCAGAGGGAGTGAGG + Intergenic
937362233 2:121237350-121237372 CCTCACCTGCGGGGGGTTGGTGG - Intronic
937374448 2:121326009-121326031 CCCCACGTGTCGAGGGAGGGAGG - Intergenic
938228986 2:129641562-129641584 GTCCACCTGCAGAGGGAGAGGGG - Intergenic
938459140 2:131486356-131486378 CCTGGCCTGCAGAGGGACTGTGG - Intronic
938595695 2:132785120-132785142 CCTCAGGTACAGAGGGAGAGGGG - Exonic
939147111 2:138429052-138429074 CTTCACATGTAGAGGGCGGGAGG + Intergenic
940598677 2:155828830-155828852 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
941509092 2:166383857-166383879 CCCCACCTGTTGAGAGAGGGAGG + Intergenic
941917880 2:170823849-170823871 CCTGGCCTGCTGAGGGTGGGGGG + Intronic
942161762 2:173196326-173196348 CCTGACCTACACAGGGAGGGAGG - Intronic
942197397 2:173535078-173535100 CCCCACCTGTTGAAGGAGGGAGG + Intergenic
942398302 2:175575370-175575392 CTTCACATGGAGAGGGAGGGAGG - Intergenic
942957293 2:181788103-181788125 CCTCACCTGCAATGGGAGATGGG + Intergenic
943127078 2:183806924-183806946 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
944026779 2:195179870-195179892 CCCCACGTGTGGAGGGAGGGAGG - Intergenic
944132091 2:196357666-196357688 CCCCACATGTCGAGGGAGGGAGG + Intronic
944603764 2:201330916-201330938 CCTCACTTCCTGTGGGAGGGTGG - Intronic
944941022 2:204626958-204626980 CCCCACCTGTCAAGGGAGGGAGG + Intronic
946575435 2:221070987-221071009 CCCCACCTGTTGGGGGAGGGGGG - Intergenic
947712906 2:232326057-232326079 GCTCCCCAGGAGAGGGAGGGAGG + Intronic
947732590 2:232439498-232439520 GCTCCCCAGGAGAGGGAGGGAGG + Intergenic
947980579 2:234405318-234405340 CCTCACCTGCAGCTGGCTGGAGG - Intergenic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948137246 2:235645680-235645702 CCCTTCCTGCAGAGGGAGGTGGG + Intronic
948280996 2:236747986-236748008 ATTCTCCTGTAGAGGGAGGGAGG + Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1168943921 20:1735883-1735905 CCGCAGCAGGAGAGGGAGGGAGG - Intergenic
1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG + Intergenic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1169456100 20:5753877-5753899 TCTCCCATGCAGAGGGAGGGGGG - Intronic
1170158867 20:13292830-13292852 GTTCTCCAGCAGAGGGAGGGAGG + Intronic
1170714218 20:18817990-18818012 ACTCACCTTCAGAGCCAGGGAGG - Intronic
1170885095 20:20333888-20333910 CCTCCCCTGACGAGGGAGGGAGG - Intronic
1171367551 20:24636380-24636402 TCTCTCCTGCAGAGAGAGAGGGG + Intronic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174274042 20:49390649-49390671 CCTCCCCTGCAGCTGGATGGAGG + Intronic
1174578394 20:51553766-51553788 CCTCCCTGGCAGAGGGATGGCGG - Intronic
1174683563 20:52431600-52431622 CCCCACCTGTTGAGGGAGGGAGG - Intergenic
1174685730 20:52453098-52453120 CCCCACGTGTTGAGGGAGGGAGG + Intergenic
1174955161 20:55089716-55089738 CCTCACATGCCCAGAGAGGGGGG - Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1175221705 20:57421080-57421102 CCTCACCTCCTAAGGGCGGGAGG + Intergenic
1175473047 20:59246864-59246886 CTTCAGCTGCACAGGCAGGGAGG - Intronic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1175811957 20:61863273-61863295 CCTCACCTGCAGCCGGGGCGGGG + Intronic
1176185914 20:63778973-63778995 CCTGACCTGCAGATGGCGGCAGG + Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1177084274 21:16682459-16682481 CCCCACGTGTAGAGGGAGGGAGG - Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1177355275 21:19998832-19998854 CTCCACCTGCTGAGGGAGGTCGG - Intergenic
1178271513 21:31194093-31194115 TCTCTCCTGCAGAGAGAGAGGGG - Intronic
1178490516 21:33048123-33048145 CCCCACCTGCAGAGGCAAGCAGG + Intergenic
1178932250 21:36829808-36829830 CCTCTCCCGCAGAGGGAAGGAGG + Intronic
1179088406 21:38241312-38241334 ACTCCACTGCAGAGGGAGGGTGG - Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179600531 21:42474654-42474676 TCTGACTTGCACAGGGAGGGTGG - Intronic
1179659319 21:42864451-42864473 CATGCCCTGCAGAGGGATGGAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1179789799 21:43749757-43749779 CCACCACAGCAGAGGGAGGGTGG + Intronic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180109322 21:45640720-45640742 CCTCCCCAGCAGGGGGATGGAGG + Intergenic
1180163518 21:46008559-46008581 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
1181084267 22:20432073-20432095 GCGCAACTGCAGAGGCAGGGAGG - Intronic
1181325600 22:22043478-22043500 TCTCACCTGAATAGTGAGGGTGG - Intergenic
1181345177 22:22214836-22214858 TCTCACCTGCAGAGTGAGTGAGG - Intergenic
1181437933 22:22921198-22921220 CTTCACCCCCAGAGGGAGAGGGG - Intergenic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181573886 22:23782057-23782079 CCCCACCCGCAGAGGGAAGCGGG - Intronic
1181660912 22:24348057-24348079 CCTCACATGAAGAGGCAGCGTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1182351153 22:29700750-29700772 CATCTCCAGCAGAGAGAGGGAGG + Intergenic
1183319098 22:37154261-37154283 CCTCAGATGGAGAGGCAGGGAGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183704867 22:39470141-39470163 CCTCGCCAGCAGGGTGAGGGCGG + Intronic
1183829120 22:40408725-40408747 GGTCACCAGCAGTGGGAGGGCGG + Intronic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1184235124 22:43179230-43179252 GCAGGCCTGCAGAGGGAGGGAGG + Intronic
1184916821 22:47575036-47575058 CCTCAGCTCCAGAGGAAGGAGGG - Intergenic
1185109393 22:48892706-48892728 CCTCCCCAGCAGAGAGCGGGAGG + Intergenic
1185335302 22:50268603-50268625 GGTCACCTGCAAAGGGAGGGTGG - Intronic
1185349230 22:50326023-50326045 GCCCACCTGCAGATGGAGGGAGG - Intronic
949609127 3:5686134-5686156 TCTCTCCTGCAGAGAGAGAGGGG + Intergenic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
950034911 3:9878428-9878450 CCTCACCTGGAGAGGGACTTGGG + Exonic
950573830 3:13818907-13818929 TCTGACTTGCAGCGGGAGGGTGG + Exonic
950698895 3:14726412-14726434 CATCCACTGCAGAGGGAGGCCGG + Intronic
952390110 3:32872786-32872808 CCTCACCTGGAGATGAAGTGTGG + Intronic
952778798 3:37072877-37072899 CTTCTCCTGCAGAGGAAGAGGGG + Exonic
953359054 3:42278983-42279005 CCCCACCTGTTGAAGGAGGGAGG + Intergenic
953359323 3:42280977-42280999 CCCCACCTGTCGAGGGAGGGAGG + Intergenic
953503137 3:43457570-43457592 CCCCACATGTTGAGGGAGGGAGG - Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
953609227 3:44433653-44433675 CCGGACCTGCAGAGAGAGAGTGG + Intergenic
954036159 3:47852363-47852385 CACCACCTGCATGGGGAGGGGGG + Exonic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954866993 3:53738084-53738106 CCCGACCAGCAGAGGGAGGCTGG + Intronic
956864439 3:73355565-73355587 CAGCACCTTCAGAGGGAGCGGGG + Intergenic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
958025752 3:88046920-88046942 CCCCACATGTTGAGGGAGGGAGG + Intergenic
958406753 3:93763004-93763026 CCCCACCTCCAGACGAAGGGTGG + Intergenic
958406908 3:93763533-93763555 CCCCACCTCCAGAAGAAGGGCGG + Intergenic
958407151 3:93764393-93764415 CCCCACCTCCAGACGAAGGGCGG + Intergenic
959327640 3:104957142-104957164 CATCACATGTGGAGGGAGGGAGG + Intergenic
959500556 3:107101884-107101906 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
959677690 3:109055139-109055161 CCTTACGTGGAGAGTGAGGGTGG + Intronic
960101470 3:113747022-113747044 CCTCAGCTGCACAGGTTGGGGGG - Exonic
960419491 3:117426404-117426426 TATCACCTGTAAAGGGAGGGAGG - Intergenic
960842314 3:121972421-121972443 TCTCCCCTGCAGAGAGAGAGGGG - Intergenic
960937373 3:122912229-122912251 CCTCACCTGGGGAGGGTGCGGGG + Exonic
960950868 3:122997663-122997685 TCTTTGCTGCAGAGGGAGGGAGG - Intronic
960975492 3:123169836-123169858 GTTGACCGGCAGAGGGAGGGAGG + Intronic
961468670 3:127097592-127097614 CCTCACCTGCACAGCCAGAGTGG + Intergenic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
962038835 3:131683531-131683553 CCTCTCCTCAAGTGGGAGGGAGG + Intronic
962400098 3:135050997-135051019 CTTCTCCTGCAGAGAGAGAGGGG + Intronic
962751212 3:138435681-138435703 CCTATCCGGCGGAGGGAGGGAGG - Intronic
962774119 3:138642675-138642697 CCCCACGTGTTGAGGGAGGGAGG + Intergenic
963478240 3:145833971-145833993 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
963939440 3:151085398-151085420 CCTCACCTGCGCCGGGAGCGTGG - Intergenic
964628709 3:158784934-158784956 CCTCACCTGGAGAGGGATGAGGG + Intronic
964970463 3:162553687-162553709 CCTCATGTGTTGAGGGAGGGAGG - Intergenic
965446770 3:168782560-168782582 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
966821073 3:183924994-183925016 CCGCACCTGCAAAGGAAGAGTGG + Intronic
966828240 3:183983625-183983647 CACCACCTGCAGAGGGAAGGCGG + Intronic
967915266 3:194573729-194573751 CCTCACCAGCACAGGGAGCCAGG - Intergenic
968482884 4:844576-844598 CCCCACATGTTGAGGGAGGGAGG - Intergenic
968744984 4:2355082-2355104 CCTCACGTGCCAAGGGACGGTGG - Intronic
968949914 4:3685179-3685201 CCACACCTGCACAGAGAGGCTGG - Intergenic
969123028 4:4923703-4923725 CCCCACTTGTCGAGGGAGGGGGG + Intergenic
969349154 4:6588223-6588245 TCACACCTTCAGAGGGAGCGTGG - Intronic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
969670709 4:8588581-8588603 CATCCCCTGCAGAGGTAGGGTGG + Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
969935612 4:10677524-10677546 CCCCAGGTGCTGAGGGAGGGAGG + Intronic
971242071 4:24898206-24898228 CCTCACCTGGAGAGGGTTGGGGG + Intronic
971635365 4:29049819-29049841 GATCATCTGCAGAGGGAGCGGGG + Intergenic
972103574 4:35453037-35453059 CCACACATGTTGAGGGAGGGAGG - Intergenic
972436359 4:39039292-39039314 CTTCATATGCAGGGGGAGGGTGG + Intergenic
972647508 4:40982967-40982989 CCTGACCTGCAGGGTGAAGGTGG + Intronic
972691818 4:41406512-41406534 CCCTCCCTGGAGAGGGAGGGAGG - Intronic
973080337 4:45983701-45983723 CCCCACATGTTGAGGGAGGGAGG + Intergenic
974620574 4:64348378-64348400 CCTCACATGTTGAGGGCGGGAGG - Intronic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
976465389 4:85362564-85362586 TCTCCCCTGCAGAGAGAGAGGGG + Intergenic
976673337 4:87678015-87678037 CCTGACTAGCGGAGGGAGGGTGG + Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
977248389 4:94660767-94660789 CCTCAGCTGGAGAGGAAGGCAGG - Intronic
978734700 4:112072768-112072790 CCCCACGTGTGGAGGGAGGGAGG - Intergenic
979072685 4:116229717-116229739 TCCCACATGTAGAGGGAGGGAGG - Intergenic
980084335 4:128376473-128376495 CCCCACATGTCGAGGGAGGGAGG - Intergenic
980292972 4:130869526-130869548 CCCCACGTGCTGAGGGAGGAAGG + Intergenic
981073344 4:140568159-140568181 GCTCACGCGCAGATGGAGGGAGG + Intronic
982066942 4:151662612-151662634 CCTCACCGGCAGGGGCAGGTTGG - Exonic
982699399 4:158642863-158642885 TCTCTCCTGCAGAGAGAGAGGGG + Intronic
983491802 4:168398134-168398156 CCAAACCTGCAGAGGGAAGGGGG - Intronic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
984138988 4:175978373-175978395 CCCCACCTGTCGAGGAAGGGAGG - Intronic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
984791567 4:183619579-183619601 CCCCTCCTGCAGGGGGAGGGGGG + Intergenic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
986006501 5:3672894-3672916 CCCCACATGTGGAGGGAGGGAGG + Intergenic
986503787 5:8429174-8429196 TCTCACATGCAGAGAGAGTGAGG + Intergenic
986505275 5:8443292-8443314 CCCCACGTGTCGAGGGAGGGAGG - Intergenic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
987967061 5:24891088-24891110 CCTCACCTTTAGAGGGATGCTGG - Intergenic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
988678285 5:33457091-33457113 ACCCACCTGCAGATTGAGGGAGG + Intronic
988928669 5:36014393-36014415 CCCCACTTGTCGAGGGAGGGAGG + Intergenic
989659066 5:43779352-43779374 CCCCACATGTTGAGGGAGGGAGG - Intergenic
990939585 5:61188347-61188369 CCCCACGTGTTGAGGGAGGGAGG + Intergenic
992325265 5:75654196-75654218 TGTCACCAGCAGATGGAGGGAGG - Intronic
992402009 5:76420133-76420155 CATCACCAGTAGTGGGAGGGTGG - Intronic
993331690 5:86608032-86608054 CCCCACATGTCGAGGGAGGGAGG - Intergenic
993713640 5:91252849-91252871 CCCCACGTGTTGAGGGAGGGAGG + Intergenic
994219942 5:97183865-97183887 CCTTACCTCCAGAGGAAGTGGGG + Intergenic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
995525868 5:113050241-113050263 GCTCACCTTGAAAGGGAGGGAGG - Intronic
995831668 5:116361478-116361500 CAGGACCTGCGGAGGGAGGGAGG - Intronic
996508587 5:124294217-124294239 CCTCACATGTTGAGGGAGGGAGG + Intergenic
996660343 5:125995448-125995470 CCCCACTTGTCGAGGGAGGGAGG + Intergenic
997356348 5:133265451-133265473 TGTCACCTCCAGAGGCAGGGTGG - Intronic
998882383 5:146656783-146656805 CCTCACCCGCACAGTGAAGGTGG - Intronic
999279148 5:150353503-150353525 CCTCTCCTGAAGAAGAAGGGAGG - Intergenic
1000341358 5:160279582-160279604 CCTCACCTGCTGAGGGCAGTGGG + Intronic
1000881487 5:166703218-166703240 TCCCACGTGAAGAGGGAGGGTGG - Intergenic
1001286186 5:170425734-170425756 CCTCACCTGGAGAGGTCTGGTGG - Intronic
1001295655 5:170496985-170497007 CCTCAGCAGCAGAGGTAGAGAGG + Intronic
1002407268 5:179044898-179044920 CCTAAACTCCAGAGGGAGGAGGG + Intergenic
1002418150 5:179131610-179131632 AGGCACCTTCAGAGGGAGGGTGG + Intronic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002824424 6:760427-760449 CCCCACATGTGGAGGGAGGGAGG - Intergenic
1003175283 6:3749551-3749573 CCTCACCTGGAGCAGGAGGGAGG - Intronic
1003504416 6:6728050-6728072 CTTCACCTGGAGTGGGGGGGGGG - Intergenic
1003925064 6:10870091-10870113 TCTCTCCTGCAGAGAGAGAGGGG + Intronic
1004609105 6:17222269-17222291 CCCCACATGTCGAGGGAGGGAGG + Intergenic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1005344641 6:24877303-24877325 TCTCTCCTGGAGAGGGAGGGAGG - Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006256326 6:32835471-32835493 CTTCACTTGCAGAGGGACAGTGG + Intronic
1006449665 6:34098854-34098876 CCTTAGCTGCAGAGAGGGGGTGG + Intronic
1006887586 6:37395442-37395464 CATCAGCTGCAGAGCCAGGGCGG - Intergenic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008325944 6:50181794-50181816 CCTCACGTGTCGAAGGAGGGAGG + Intergenic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1009929514 6:70160373-70160395 CCCCACATGTAGAGGGAGGGAGG - Intronic
1012217948 6:96611778-96611800 ACTGACTTGCAAAGGGAGGGAGG + Intronic
1014943465 6:127470340-127470362 CCCCACATGTAGAGGGAGGCAGG - Intronic
1015565176 6:134562860-134562882 CCTCAATTGCAGAGGGCAGGTGG - Intergenic
1017142754 6:151206710-151206732 CCTCACGTGGAGAGGAAGAGAGG - Intergenic
1017299257 6:152836348-152836370 CCCCACCTGTCGAGGGAGGGAGG - Intergenic
1018892293 6:167990623-167990645 CCTCAGGAGCAGAGGGACGGGGG - Intergenic
1019082685 6:169445929-169445951 GCTCTGTTGCAGAGGGAGGGGGG - Intergenic
1019143326 6:169961911-169961933 CCTCACCTCCAGAGCGATGGTGG - Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019639960 7:2098018-2098040 CTTCACCTCCAGCGGGAGGAAGG + Intronic
1019816062 7:3201810-3201832 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
1020101041 7:5394590-5394612 CCTCGCCTGCAGAGAGAAGTTGG + Exonic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1020804324 7:12769741-12769763 CCTCACTTACACAGGCAGGGAGG + Intergenic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1022062484 7:26811641-26811663 TATCACCTGCAGGTGGAGGGGGG - Intronic
1022248803 7:28586478-28586500 CTTCAGCTGGAGAGGGAAGGGGG - Intronic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1022472002 7:30687809-30687831 CCTCACCCTCAGAGGCAGCGTGG - Intronic
1022974549 7:35545408-35545430 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1023525062 7:41093348-41093370 CGTCACCTGAGGAGGGAGGAGGG + Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1026162147 7:67878845-67878867 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
1026932942 7:74234955-74234977 TCCCAACTGCAGTGGGAGGGAGG - Intronic
1028041649 7:86061107-86061129 CCCCACCTGTTGAGGCAGGGAGG - Intergenic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1029473275 7:100767814-100767836 ATTCAGCTGCAGAGGCAGGGAGG - Exonic
1029477593 7:100794197-100794219 CTTCAGCTGCAGAGCGGGGGAGG + Exonic
1030381876 7:108821056-108821078 CCCCACATGTCGAGGGAGGGAGG - Intergenic
1031134547 7:117872220-117872242 CCCTACCTCCAGAGGGTGGGAGG + Intronic
1031419985 7:121539843-121539865 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
1031436903 7:121743195-121743217 GATCACATGCAAAGGGAGGGTGG + Intergenic
1034098930 7:148435502-148435524 CGGCTCCTGCAGAGGGAGGGAGG - Intergenic
1034343551 7:150372352-150372374 TCGCAGCTGTAGAGGGAGGGGGG - Exonic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034696367 7:153057678-153057700 CCTCACCTGGAGAGGAAATGTGG + Intergenic
1035018599 7:155787517-155787539 CCTGGCCTGCAGCGGGCGGGCGG - Intergenic
1035055415 7:156031985-156032007 GTTCACCGGCAGAGGCAGGGAGG - Intergenic
1035224990 7:157428028-157428050 CGTCCCCAGCAGAGGGAGGAGGG + Intergenic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035546447 8:485352-485374 TTTCACCTGCGGAGGGAGTGGGG + Intergenic
1035557603 8:578482-578504 CTTCACCTGCCGAGGGACAGGGG - Intergenic
1035787580 8:2274203-2274225 CCCCACATGCCGAGGGAGGGAGG + Intergenic
1035805230 8:2447513-2447535 CCCCACATGCCGAGGGAGGGAGG - Intergenic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036240159 8:7074448-7074470 CCTCACATCCAGAGGGAGAGAGG - Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036916927 8:12813026-12813048 TCTCTCCTGCAGAGAGAGAGAGG - Intergenic
1037061047 8:14509946-14509968 CCTCACCTGTTGAGGGAGGGAGG - Intronic
1037605570 8:20434875-20434897 CCTCACCTTCGTAGGGAGGATGG - Intergenic
1037876033 8:22548968-22548990 CCTCCCCTGCAGGGGGGTGGGGG + Intronic
1038381180 8:27095851-27095873 TCTCTCCTGCAGAGAGATGGGGG - Intergenic
1038424839 8:27458493-27458515 ACCCACCTGCAGAGTGACGGAGG + Exonic
1038516040 8:28188460-28188482 CCTCCCCGGAGGAGGGAGGGTGG - Intronic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1039790832 8:40874349-40874371 GCTCACCTGAAGATGGTGGGTGG + Intronic
1039863092 8:41476601-41476623 TCCCACCTTCAGAGGGAGCGCGG - Intergenic
1040681052 8:49809746-49809768 CCTCACATGTTGAGGGAGGGAGG + Intergenic
1040721334 8:50328645-50328667 CCCCACATGCTGAGGGAGGGAGG - Intronic
1040721624 8:50330897-50330919 CCTCACATGTCAAGGGAGGGAGG - Intronic
1041566110 8:59280731-59280753 CCACACCTGGAGAGGGTGGTTGG - Intergenic
1042898278 8:73694883-73694905 CAGCACCTGCACAGGGAGGGAGG + Intronic
1044544635 8:93445943-93445965 TCTCAGCTGCAAAGGAAGGGAGG - Intergenic
1045306890 8:100965411-100965433 TCCCACATGTAGAGGGAGGGAGG - Intergenic
1045375184 8:101565571-101565593 TCTCCCCAGCAGAGGAAGGGAGG + Intronic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1045684931 8:104702221-104702243 CCTCACCTGTCGAGGGAGGGAGG + Intronic
1045777473 8:105822637-105822659 TCTCTCCTGCAGAGAGAGGGGGG + Intergenic
1045810266 8:106213157-106213179 ATACACCTGCAGTGGGAGGGTGG - Intergenic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1046512925 8:115221648-115221670 TCCCCCATGCAGAGGGAGGGGGG - Intergenic
1046858033 8:119057102-119057124 CCCCACGTGTTGAGGGAGGGAGG + Intronic
1047875961 8:129137894-129137916 CCCGACATGTAGAGGGAGGGAGG + Intergenic
1048054990 8:130854847-130854869 AGTGACCTACAGAGGGAGGGAGG - Intronic
1048179546 8:132182487-132182509 CCTCATCTCCCCAGGGAGGGTGG + Intronic
1048316274 8:133364851-133364873 TCTCTCCTGCAGAGAGAGAGGGG - Intergenic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049421355 8:142517980-142518002 CCTCGTCTGCAGGGGGCGGGTGG + Intronic
1049603123 8:143517286-143517308 CCTCAGGTGCAGGGGAAGGGAGG + Intronic
1049665227 8:143840025-143840047 CTTCTCCTGGGGAGGGAGGGTGG + Exonic
1049775284 8:144401145-144401167 ACCCAGCTGCAGGGGGAGGGAGG + Intronic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1049855072 8:144856629-144856651 CTTCACCTGCAGACAGTGGGTGG - Intergenic
1050196412 9:3088490-3088512 TCTCTCCTGCAGAGGGAGAGGGG - Intergenic
1050422315 9:5478447-5478469 CCCCACGTGTTGAGGGAGGGAGG - Intergenic
1050890436 9:10818541-10818563 TCCCACCTGGTGAGGGAGGGAGG - Intergenic
1052739751 9:32382165-32382187 CCCCACCTGTGGAGGGAAGGAGG + Intergenic
1053218539 9:36292792-36292814 GCTGACCTGCAGAGGGCAGGAGG - Intronic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054809741 9:69425399-69425421 CCTCACCCTCAGAGGAAGGGAGG - Intergenic
1056807955 9:89743424-89743446 CCTCACCTGCAGAGCCCAGGAGG + Intergenic
1056929335 9:90861538-90861560 CCTTTCCTGCAGTGGGAGAGTGG + Intronic
1056929345 9:90861578-90861600 CCTTTCCTGCAGTGGGAGAGTGG + Intronic
1057818630 9:98314596-98314618 CCTCACCGGGAGCAGGAGGGAGG - Intronic
1058674617 9:107389733-107389755 CCTCACTGGCAGAGGGAGAGTGG - Intergenic
1059563468 9:115358426-115358448 CCTCATGTGTTGAGGGAGGGAGG + Intronic
1059586391 9:115611985-115612007 CCTTAGCTGTTGAGGGAGGGAGG + Intergenic
1059997344 9:119924939-119924961 CCTCACCTGCAGAGGGCTTTAGG + Intergenic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060035869 9:120255234-120255256 CCCCACATGTTGAGGGAGGGAGG - Intergenic
1060045048 9:120333214-120333236 CCTAACCTGCAGCAGCAGGGGGG + Intergenic
1060218428 9:121752100-121752122 CCTAACCTTGAGAGGGATGGGGG + Intronic
1060225486 9:121787448-121787470 TCTCCCCAGCAGAGGGATGGTGG - Intergenic
1060295523 9:122340582-122340604 CCTCACCTGCCCAGGGATGTGGG - Intergenic
1060406403 9:123375200-123375222 TGACACCTGGAGAGGGAGGGGGG - Exonic
1060417054 9:123438296-123438318 GATTAGCTGCAGAGGGAGGGGGG - Intronic
1061149599 9:128821265-128821287 TCGGACCTGCAGAGGGAAGGTGG - Exonic
1061232290 9:129321841-129321863 CCTCACCTGTCGGGGGAGGTGGG + Intergenic
1061303423 9:129719214-129719236 ACTCACCTGCGGAGGTTGGGGGG - Exonic
1061330043 9:129886454-129886476 CCTCACTTGCGGAGGGCAGGAGG - Intergenic
1061509169 9:131049976-131049998 CCTCTCTGGCAGAGGGAGGGAGG - Intronic
1061509595 9:131052566-131052588 CCTCAGCTGTACAGGGAGTGGGG - Exonic
1062068756 9:134543885-134543907 CCTGTCCTGCACAGAGAGGGTGG - Intergenic
1062259003 9:135648656-135648678 TCTCACCTGCGGAGAGAGAGGGG + Intergenic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1186196099 X:7111461-7111483 GCTGACCTGCAGAGCGGGGGTGG + Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1187571892 X:20512662-20512684 GGGCACCTGCTGAGGGAGGGTGG + Intergenic
1188270893 X:28139417-28139439 CTCCTCCTGCAGAGGAAGGGAGG + Intergenic
1189324126 X:40102770-40102792 CCTCGCCTGCAGCAGGAAGGTGG + Intronic
1189377009 X:40474292-40474314 CCTCACCTGAGAAGGGAGGAGGG + Intergenic
1189715372 X:43859486-43859508 CATCAGCTGAAGAGGGATGGAGG - Intronic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1190300411 X:49053890-49053912 CCCCGCCTGCGGAGGAAGGGAGG + Intronic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192841126 X:74857253-74857275 CCTCTCCTGAAGAGGAAGGAAGG - Intronic
1193140198 X:78018988-78019010 CCCCACATGCCAAGGGAGGGAGG - Intronic
1194550245 X:95289344-95289366 TCTCTCCTGCAGAGAGAGAGTGG - Intergenic
1194969871 X:100331623-100331645 CCCCACCTGTTAAGGGAGGGAGG + Intronic
1195668106 X:107448886-107448908 GTTCACCAGCAGATGGAGGGAGG - Intergenic
1196362761 X:114885016-114885038 CCTAACCAGAGGAGGGAGGGTGG + Intronic
1196794419 X:119490768-119490790 CTGCACCTGCAGAGGGAGATTGG - Intergenic
1197740449 X:129888443-129888465 CCCCACGTGTTGAGGGAGGGAGG + Intergenic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic
1200106341 X:153715355-153715377 CCTGACCTCCAGAGGCAGCGTGG - Intronic
1200247891 X:154535554-154535576 CTGCACATCCAGAGGGAGGGAGG + Intronic