ID: 1179524222

View in Genome Browser
Species Human (GRCh38)
Location 21:41965359-41965381
Sequence GCCCCCTGCCCACTATCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179524222_1179524225 4 Left 1179524222 21:41965359-41965381 CCACTGGATAGTGGGCAGGGGGC No data
Right 1179524225 21:41965386-41965408 GCAGGACTGCAATGAGCCTGTGG No data
1179524222_1179524228 30 Left 1179524222 21:41965359-41965381 CCACTGGATAGTGGGCAGGGGGC No data
Right 1179524228 21:41965412-41965434 TTGTTCCTACAGCAAAAGAAAGG No data
1179524222_1179524226 5 Left 1179524222 21:41965359-41965381 CCACTGGATAGTGGGCAGGGGGC No data
Right 1179524226 21:41965387-41965409 CAGGACTGCAATGAGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179524222 Original CRISPR GCCCCCTGCCCACTATCCAG TGG (reversed) Intergenic
No off target data available for this crispr