ID: 1179525575

View in Genome Browser
Species Human (GRCh38)
Location 21:41973968-41973990
Sequence TCTCCAGGGTCCCCAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179525567_1179525575 14 Left 1179525567 21:41973931-41973953 CCACTTGTATCTTCCTTCTCAGA No data
Right 1179525575 21:41973968-41973990 TCTCCAGGGTCCCCAGCAGGAGG No data
1179525569_1179525575 1 Left 1179525569 21:41973944-41973966 CCTTCTCAGAGGCTTCTCTGTGG No data
Right 1179525575 21:41973968-41973990 TCTCCAGGGTCCCCAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179525575 Original CRISPR TCTCCAGGGTCCCCAGCAGG AGG Intergenic