ID: 1179525734

View in Genome Browser
Species Human (GRCh38)
Location 21:41974751-41974773
Sequence ATTTGGGAAGTCCTGTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179525724_1179525734 26 Left 1179525724 21:41974702-41974724 CCAAACCCTGCAGTTTCGTAAGA No data
Right 1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG No data
1179525726_1179525734 20 Left 1179525726 21:41974708-41974730 CCTGCAGTTTCGTAAGAGCCCAG No data
Right 1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG No data
1179525730_1179525734 1 Left 1179525730 21:41974727-41974749 CCAGGGTTTTGAATGCACATTAA No data
Right 1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG No data
1179525729_1179525734 2 Left 1179525729 21:41974726-41974748 CCCAGGGTTTTGAATGCACATTA No data
Right 1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG No data
1179525725_1179525734 21 Left 1179525725 21:41974707-41974729 CCCTGCAGTTTCGTAAGAGCCCA No data
Right 1179525734 21:41974751-41974773 ATTTGGGAAGTCCTGTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179525734 Original CRISPR ATTTGGGAAGTCCTGTCCTA GGG Intergenic
No off target data available for this crispr