ID: 1179528422

View in Genome Browser
Species Human (GRCh38)
Location 21:42000071-42000093
Sequence GGTGGTAGCAACGGAGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179528412_1179528422 9 Left 1179528412 21:42000039-42000061 CCCAGATGAGAGAGGATGGTGGC 0: 1
1: 3
2: 19
3: 57
4: 293
Right 1179528422 21:42000071-42000093 GGTGGTAGCAACGGAGGTAAAGG 0: 1
1: 0
2: 1
3: 15
4: 186
1179528413_1179528422 8 Left 1179528413 21:42000040-42000062 CCAGATGAGAGAGGATGGTGGCT 0: 2
1: 13
2: 50
3: 175
4: 679
Right 1179528422 21:42000071-42000093 GGTGGTAGCAACGGAGGTAAAGG 0: 1
1: 0
2: 1
3: 15
4: 186
1179528408_1179528422 21 Left 1179528408 21:42000027-42000049 CCACTGTAATGACCCAGATGAGA 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1179528422 21:42000071-42000093 GGTGGTAGCAACGGAGGTAAAGG 0: 1
1: 0
2: 1
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179528422 Original CRISPR GGTGGTAGCAACGGAGGTAA AGG Intronic
900661022 1:3783763-3783785 GGTGTTAGGAGCGGAGGTATTGG - Intronic
902571871 1:17352238-17352260 GGTGGTAGCAGAGGTGGTCAAGG + Intronic
905215604 1:36405289-36405311 GGTGGTAGCAACTGCAGAAATGG - Intergenic
905895718 1:41544777-41544799 GATGGTAGCAGTGGAGGTAGAGG - Intronic
905895865 1:41545440-41545462 GATGGTAGCAATGGTGGTAGAGG - Intronic
908716561 1:67077013-67077035 GGAGGAAGCAAGGGAGGTAACGG + Intergenic
910674797 1:89806056-89806078 GGTGGGAGCTACACAGGTAAAGG - Intronic
911021873 1:93397298-93397320 TGTGGTATCAAAGGTGGTAAAGG + Intergenic
911393598 1:97277213-97277235 GGAGGAAGGAAAGGAGGTAAGGG + Intronic
915068236 1:153244186-153244208 GGTGGTAGAAATGGAGGTGGTGG + Intergenic
915068378 1:153244940-153244962 GGTGGTAGCAATGGAGATGGGGG + Intergenic
922780269 1:228246881-228246903 GTTGGAAACAACAGAGGTAAAGG - Intronic
924419614 1:243896031-243896053 TGTGGTGGCAGTGGAGGTAAGGG - Intergenic
1063086924 10:2828267-2828289 TGTGGGAGAAATGGAGGTAATGG + Intergenic
1065191817 10:23218635-23218657 GATGGTAACAAGGGAAGTAATGG + Intronic
1067252689 10:44601131-44601153 GGATGAAGCAAGGGAGGTAAGGG + Intergenic
1068059847 10:52053196-52053218 GGTGGTTGAAACTGAGGGAAAGG + Intronic
1070793486 10:79203487-79203509 GGTGGGAGAAACGGAGTGAAAGG - Intronic
1071581595 10:86776607-86776629 GGAAGTAGCAAAGGGGGTAAAGG - Intronic
1071743682 10:88390785-88390807 GGTAGTAGTCAGGGAGGTAAGGG + Intronic
1072554042 10:96501225-96501247 GGTGGTGGAAAGGGAGATAATGG - Intronic
1073104878 10:101026887-101026909 GTTGGTAGCAAGGGAGTAAAAGG - Intronic
1075069717 10:119312929-119312951 GGTGGTAGTGATGGTGGTAATGG + Intronic
1075244414 10:120807941-120807963 GGTAGGAGGAAAGGAGGTAAGGG - Intergenic
1076738877 10:132471298-132471320 GGTGCTTGCCACGGAGCTAAAGG + Intergenic
1077585503 11:3448661-3448683 GGTGTCAGAAACGGAGGCAATGG - Intergenic
1077776503 11:5278024-5278046 AGTGGTAGCATTGGAGGTGAAGG + Intronic
1078089656 11:8256954-8256976 GGTGGTAGCAGAGGAGAAAAGGG + Intronic
1078859427 11:15233708-15233730 GGAGGGAGGAAGGGAGGTAAAGG - Intronic
1079927513 11:26513158-26513180 GGTAGTAGCAGAGGAGGTATGGG + Intronic
1081693400 11:45093597-45093619 GGTGGCAGCAATGGAGGTGGTGG - Intergenic
1081744890 11:45466052-45466074 GGTGGTGGCATGGGTGGTAAAGG - Intergenic
1084667630 11:70585009-70585031 GGTGGTAGCCACGGAGCTCAGGG - Intronic
1086826956 11:91510051-91510073 GGTGGTAGAAGCGGAGGTGGTGG - Intergenic
1086938281 11:92767800-92767822 GTTGGTAGCAACAGAGGTTTTGG - Intronic
1090078528 11:123594711-123594733 TGTGGTAGGAGCGGAGGTAGGGG - Intronic
1091668734 12:2437695-2437717 GGTGGTGGCAATGATGGTAATGG + Intronic
1092067504 12:5604077-5604099 GGTGATAGCAACGGACATGAAGG + Intronic
1092629802 12:10365040-10365062 GCTGGCAGCTACGGAGTTAAAGG + Intergenic
1094359767 12:29617786-29617808 GGAAGTAGCAAGGGAGATAATGG + Intronic
1097258336 12:57697385-57697407 GGTGGTGGCAGTGGAGGTGATGG + Intronic
1099603508 12:84771452-84771474 GGTGGTAGCAGTGGAGATAATGG + Intergenic
1099852806 12:88123997-88124019 GGTGGTAGCAGTGGAGTTACTGG - Intronic
1102018032 12:109661354-109661376 GGTGGTAGGAATGGTGGTAATGG - Intergenic
1102018073 12:109661637-109661659 GGTGGTAGGAATGGTGGTAATGG - Intergenic
1102018126 12:109661972-109661994 GGTGGTAGGAATGGTGGTAATGG - Intergenic
1105453174 13:20518350-20518372 CATTTTAGCAACGGAGGTAAGGG + Intronic
1109550961 13:63899545-63899567 GGTGGTAGTAGGGCAGGTAATGG + Intergenic
1114967386 14:27979985-27980007 GATGGAAGTAAGGGAGGTAATGG + Intergenic
1117450994 14:55849899-55849921 GGTGGTAGGAGAGGAGGCAAGGG - Intergenic
1118854131 14:69608166-69608188 GGTGGTAGGGAGGGAGGAAATGG + Intergenic
1121126314 14:91409014-91409036 GGTGCTAGGAACGGTGGGAATGG - Intronic
1122970338 14:105149848-105149870 GGTGGTAGGGAGGCAGGTAATGG + Intronic
1124393000 15:29276990-29277012 GTTGGTGGCAACAGGGGTAAGGG + Intronic
1132291967 15:100710262-100710284 GGTGGTAGAAATGGAGGTGAAGG + Intergenic
1134330522 16:13246683-13246705 GGTGGTGGAAATGGTGGTAAAGG - Intergenic
1138656455 16:58494397-58494419 GGTGGAAGGAAGGGAGGGAAGGG - Intronic
1139053790 16:63157029-63157051 GGTGCTAGAAACTGGGGTAAAGG + Intergenic
1139358129 16:66379684-66379706 GGTGGTAGCAATAGTGGTAGAGG + Intronic
1141770866 16:86088991-86089013 GGCGGGAGCAATGGACGTAAGGG + Intergenic
1143978306 17:10846472-10846494 GGTGGTGGAAATGGAGGTGATGG + Intergenic
1143978329 17:10846571-10846593 GGTGGTGGAAATAGAGGTAATGG + Intergenic
1143978354 17:10846685-10846707 GGTGGTGGAAGCGGAGGTGATGG + Intergenic
1144849889 17:18238682-18238704 GGTGGTGGCAAGGGAGGTGGTGG + Intronic
1145051589 17:19666121-19666143 GGTGGTAGCAGGGGAGATAGTGG + Intronic
1147879266 17:43643418-43643440 GGTGGTGGGAAAGGAGGGAAGGG + Intronic
1148083862 17:44982494-44982516 GGTGGTAGCGATGGAGGTGATGG + Intergenic
1148083868 17:44982530-44982552 GGTGGTAGTGATGGAGGTGATGG + Intergenic
1148083900 17:44982705-44982727 GATGGTAGCCATGGAGGTGATGG + Intergenic
1150148896 17:62793412-62793434 GGTGGTAGTGATGGAGGTGATGG - Intronic
1152408073 17:80108617-80108639 GGTGGTGGCAGGGGAGGCAAGGG + Intergenic
1152442177 17:80315636-80315658 GGTGGTGGTAATGGAGGTGATGG + Intronic
1152552141 17:81035185-81035207 GGCGGCAGCAGCGGCGGTAACGG - Exonic
1157532185 18:48430342-48430364 GGTGGTAGTAAGGGAGAGAAGGG + Intergenic
1158268040 18:55681787-55681809 GGTGGTAGTAAAGGAGGAATTGG + Intergenic
1159066380 18:63572577-63572599 GGAGGTAGCAAGGAAGGCAAAGG + Intergenic
1162857757 19:13482158-13482180 GGTGGTAGCAGTGGTGGTGATGG - Intronic
1163040088 19:14595651-14595673 GGTGGTAGTAACGATGGTAGAGG + Intronic
1165385811 19:35510197-35510219 GGTGGGAGCGGCGGAGGAAATGG - Exonic
1166303181 19:41923577-41923599 GGTGGTGGCAAAGGTGGAAATGG + Intronic
1166857615 19:45791095-45791117 GGTGGGAGAAAAGGAGTTAATGG + Intronic
1167347918 19:48958066-48958088 GGTGGTAGCAGCAGAGGTGCGGG + Intronic
1168421735 19:56208456-56208478 GGTGGGAGCAAAGGAGGGGAAGG + Exonic
1168427000 19:56246738-56246760 GGTGGGAGCAAAGGAGGGGAAGG + Exonic
925332030 2:3065919-3065941 GGTGGAAAGAACGGAGGAAAAGG + Intergenic
925595620 2:5552972-5552994 GGTGGTAGAGATGGTGGTAACGG - Intergenic
925911512 2:8576540-8576562 GGAGGAAGAAACGGAGGGAAAGG + Intergenic
926916501 2:17897029-17897051 GGAGGTAGCAAGGGGGGCAAGGG - Intronic
926931214 2:18042917-18042939 GGTGGTGGAAATGGAGGGAAGGG + Intronic
927648606 2:24897341-24897363 AGTGGTAGCAATGGAGGTGGGGG - Intronic
929269380 2:39956917-39956939 GGTGGTGGACATGGAGGTAAAGG - Intergenic
929455628 2:42062785-42062807 GGTGGTGGCAACTGGGGGAAAGG + Intergenic
930873483 2:56189724-56189746 TGGGGTAGGAAGGGAGGTAAGGG - Intronic
932147365 2:69334429-69334451 GGTGGTAACCACTGGGGTAATGG + Intronic
933867172 2:86531126-86531148 GATGTTACCAACGGAGGAAAAGG - Intronic
933911885 2:86948361-86948383 GTTGGAAGCAAAGAAGGTAATGG + Intronic
934011110 2:87821533-87821555 GTTGGAAGCAAAGAAGGTAATGG - Intronic
935774673 2:106462249-106462271 GTTGGAAGCAAAGAAGGTAATGG - Intronic
935850449 2:107213284-107213306 GGAGGTAGCATCAGAGGTTATGG + Intergenic
935905394 2:107833666-107833688 GTTGGAAGCAAAGAAGGTAATGG + Intronic
935991761 2:108725389-108725411 GTTGGAAGCAAAGAAGGTAATGG + Intronic
936127183 2:109798847-109798869 GTTGGAAGCAAAGAAGGTAATGG + Intronic
936127186 2:109798898-109798920 GTTGGAAGCAAAGAAGGTAATGG + Intronic
936217511 2:110572588-110572610 GTTGGAAGCAAAGAAGGTAATGG - Intronic
936217514 2:110572639-110572661 GTTGGAAGCAAAGAAGGTAATGG - Intronic
936426653 2:112427163-112427185 GTTGGAAGCAAAGAAGGTAATGG - Intronic
936426656 2:112427214-112427236 GTTGGAAGCAAAGAAGGTAATGG - Intronic
943815496 2:192249280-192249302 GGTGGTAGCAATGGATGTGGTGG - Intergenic
945092155 2:206185738-206185760 GGTGGTAGCAGTGAAGGTGATGG + Intronic
1169394647 20:5218895-5218917 GGTGGTAGCAAGGGAGGGAATGG - Intergenic
1170722060 20:18890309-18890331 TGTGGCAGCAATGGAGGCAAAGG - Intergenic
1174481246 20:50833034-50833056 GGAAGTAGCGACGGAGGTATGGG + Intronic
1179528422 21:42000071-42000093 GGTGGTAGCAACGGAGGTAAAGG + Intronic
1182692112 22:32171422-32171444 GGAGGAAGCAAAGGAGGTAGAGG + Intergenic
1183163169 22:36128334-36128356 GGAGGAAGCAAAGGAGGTAGAGG - Intergenic
949293027 3:2487398-2487420 GATGGTAGAAAGGGAGGGAAGGG - Intronic
950145509 3:10647067-10647089 GGTGGGAGCAATGGGGGTAGGGG + Intronic
954943967 3:54400555-54400577 GGTGGTAGCAAAGGCTGTCAGGG - Intronic
955961618 3:64346550-64346572 GGTGGTAGCAATGGAAGTGGTGG + Intronic
959197533 3:103203737-103203759 GGTGGTAGGAATTGAAGTAAAGG + Intergenic
960039571 3:113136269-113136291 GCAGGTGGCAACAGAGGTAATGG + Intergenic
960130256 3:114048216-114048238 CATGGTAGCAATGGAGGTGATGG - Intronic
963637983 3:147823555-147823577 GGTGGTAGTAACGGAGGTGGTGG - Intergenic
964398324 3:156272106-156272128 GGTGGTAGCCACGGGGGTGCTGG - Intronic
964463083 3:156958511-156958533 GGTGGTAGGAAGGGAGCAAAGGG - Intronic
968288524 3:197521991-197522013 GGTGGCAGCAAAGGAGGTTGGGG - Intronic
969753328 4:9130111-9130133 GGTGTCAGAAACGGAGGCAATGG + Intergenic
972278696 4:37583339-37583361 GAGGGTAGCAATGGAGGTAGGGG - Intronic
975108887 4:70601205-70601227 GGTGGTCCCAAAGGAGGTAGGGG + Intronic
975400922 4:73938860-73938882 GGTGGCAGCCACGGTGGTAGTGG - Intergenic
975834445 4:78407588-78407610 AGTAGTAGGAAAGGAGGTAAGGG + Intronic
976567204 4:86564678-86564700 GGTGGTAGAAAAGGAGGAAGGGG - Intronic
979980574 4:127249503-127249525 GGTGGTAGCCATGGAGGGAAGGG + Intergenic
981026756 4:140084580-140084602 AGTGGTGGGAAAGGAGGTAATGG - Intronic
981183365 4:141771908-141771930 GGTGCTAGCAATGTTGGTAAGGG + Intergenic
982346177 4:154362684-154362706 GGTGGTAGAGACGGAGGAAAGGG - Intronic
983119337 4:163860865-163860887 GGCAGTAGAAACTGAGGTAATGG - Intronic
983973641 4:173904632-173904654 TGGGGTAGCAAAAGAGGTAAAGG + Intergenic
989117353 5:37968160-37968182 GGTGGTAGAAAAGGTGGTGATGG + Intergenic
990148306 5:52787911-52787933 GGTGGTAGGAAGGCGGGTAAGGG - Exonic
990713877 5:58614626-58614648 GGTAGCAGCAAAGAAGGTAATGG - Intronic
992934696 5:81689272-81689294 GGTGGTAGAAAAAGAGATAAGGG + Intronic
993253875 5:85562026-85562048 GGGGGTAGCAAGTGAGGGAAGGG + Intergenic
994607361 5:101985874-101985896 GGTGGTTGCAGCGGAAGTACTGG - Intergenic
1002076227 5:176710100-176710122 GGTGGTAGGATCGTAGGGAAAGG - Intergenic
1006451160 6:34106523-34106545 GGTGGTAGGAAGGGAGGCCAGGG - Intronic
1008352836 6:50513823-50513845 GGTGATTGCAACTGAGGAAAAGG - Intergenic
1008765259 6:54905012-54905034 GGTAGTAGCAATGGTGGTTAAGG + Intronic
1010133345 6:72521828-72521850 GGTAACAGCAACAGAGGTAAGGG + Intergenic
1011080159 6:83481302-83481324 GGAGGTAGCAAAGGAGGCAATGG + Intergenic
1011355372 6:86467815-86467837 GGTGGTAGGAACACAAGTAATGG + Intergenic
1012839092 6:104306772-104306794 GGCAGTAGCAACAGAGGGAAAGG + Intergenic
1013911297 6:115279002-115279024 GGTGGTAGAAAAGCAGGAAAAGG + Intergenic
1016057419 6:139593051-139593073 GGGGGTAGAAACTGAGATAAGGG - Intergenic
1016306530 6:142690365-142690387 GTTGGTGGCAAGGGAGGTGAGGG - Intergenic
1019129478 6:169863130-169863152 GGTGGCAGGGACGGAGGGAAGGG - Intergenic
1023193412 7:37608398-37608420 GGTGGTAGTTACTGAGATAAAGG + Intergenic
1024569784 7:50713971-50713993 GTTGGTAGCAATGGAGGTGTTGG - Intronic
1026102293 7:67393234-67393256 GGTGGTGGCAATGGTGGAAATGG + Intergenic
1026552375 7:71379542-71379564 GGCGGTAGCAATGGAGGAGAAGG + Intronic
1028985605 7:97006352-97006374 TGTGGTAGGACTGGAGGTAAGGG - Exonic
1030497112 7:110314203-110314225 GGTGGTAATAATGGAGGTAGAGG - Intergenic
1031676583 7:124618609-124618631 GGTGGTAGGAATGGAGGCCATGG - Intergenic
1032210651 7:129911032-129911054 GGTGGTCGCAATGGAGGGCAGGG + Intronic
1033519729 7:142148443-142148465 GGTGGTGGCAACAGCAGTAAAGG - Intronic
1034065878 7:148136084-148136106 GGTGGAAGGAATGGAGGGAACGG + Intronic
1034725376 7:153330885-153330907 AGTGTTAGCAACGATGGTAAGGG - Intergenic
1035035382 7:155891132-155891154 GGGGGAGGCAATGGAGGTAATGG + Intergenic
1035190651 7:157165059-157165081 GGTTGTCACAACTGAGGTAACGG - Intronic
1035519073 8:262111-262133 GGAGATAGCAACGGAAGAAATGG + Intergenic
1036376536 8:8205442-8205464 GGTGTCAGAAACGGAGGCAATGG + Intergenic
1036569576 8:9968227-9968249 GGTGGTAGCACCAATGGTAAAGG + Intergenic
1036853000 8:12217696-12217718 GGTGTCAGAAACGGAGGCAATGG - Intergenic
1036874373 8:12460218-12460240 GGTGTCAGAAACGGAGGCAATGG - Intergenic
1037901909 8:22693407-22693429 GGTGGTAGCAGCGGCGGCAGCGG - Intergenic
1042709438 8:71699997-71700019 GGTGGAAGCCACGTAGGCAATGG - Intergenic
1046419240 8:113957889-113957911 GGTGGTAGCAACAGAAGCAGTGG + Intergenic
1047101067 8:121676369-121676391 GGTGCAAGCAACAGAGGTGAAGG + Intergenic
1047588810 8:126304048-126304070 TCTGGTAGCAACAGAGATAAGGG + Intergenic
1048607681 8:135986410-135986432 GGTGGTAGCAGTTGAGGTAGGGG + Intergenic
1048878468 8:138854878-138854900 AGTGGTAGCAATGGTGGTGATGG + Intronic
1049361753 8:142215379-142215401 GGTGGCAGCAATGGTGGTCAGGG + Intronic
1049421751 8:142519737-142519759 GGTGGTAGTGATGGTGGTAATGG + Intronic
1049571526 8:143372275-143372297 GGTGGTAGCGCCGGTGGGAAAGG + Intronic
1051045691 9:12870889-12870911 GGTGGAAGAAGAGGAGGTAAAGG + Intergenic
1053053001 9:34976988-34977010 GGAGGTTGCAAAGGTGGTAATGG + Intronic
1053238808 9:36479332-36479354 GGTGGTAGCAACAGAGGAAGAGG + Intronic
1053266957 9:36722112-36722134 AGTGGCAGCAACTGAGGTCAGGG - Intergenic
1053356165 9:37447417-37447439 GGTGACAGTAACAGAGGTAATGG + Intronic
1056480088 9:86994261-86994283 GTTGGTAGTAACAGTGGTAATGG - Intergenic
1058129872 9:101239368-101239390 GGTGGGAGAGAGGGAGGTAAGGG + Intronic
1059381540 9:113930901-113930923 GGGGGCAGCAAAGGAAGTAAAGG + Intronic
1060660395 9:125402018-125402040 GGTGGTGGCAGCTGAGGGAACGG - Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1187642888 X:21314067-21314089 GGTGGCAGAAATGGAGGTTATGG + Intergenic
1188656056 X:32696764-32696786 GGTGATTTCAACGGAGGGAATGG + Intronic
1189720000 X:43906045-43906067 GGAGGAAGCAACAGAGGTATTGG + Intergenic
1191978768 X:66902794-66902816 AGTGGTAGGAATGGAGTTAAAGG - Intergenic
1195298725 X:103506272-103506294 GGTGGGAGTAAGGGAGGGAAGGG - Intronic
1196457351 X:115899943-115899965 GGTGGTAGAAACGGAGGGAGTGG - Intergenic
1198817901 X:140612949-140612971 GGTGGTAGAGAAAGAGGTAAGGG - Intergenic
1199709020 X:150454902-150454924 GGTGGTAATGACGGAGGTAAGGG - Intronic
1199942849 X:152641581-152641603 GGAGGGAGCAAGGGAGCTAAGGG - Intronic