ID: 1179530916

View in Genome Browser
Species Human (GRCh38)
Location 21:42019118-42019140
Sequence CCGGGTCCCCAGGTGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179530916_1179530928 14 Left 1179530916 21:42019118-42019140 CCCACCAACACCTGGGGACCCGG No data
Right 1179530928 21:42019155-42019177 AAAGCACTGGGCTGGAATGTTGG No data
1179530916_1179530924 1 Left 1179530916 21:42019118-42019140 CCCACCAACACCTGGGGACCCGG No data
Right 1179530924 21:42019142-42019164 ACACACCTCTCTTAAAGCACTGG No data
1179530916_1179530925 2 Left 1179530916 21:42019118-42019140 CCCACCAACACCTGGGGACCCGG No data
Right 1179530925 21:42019143-42019165 CACACCTCTCTTAAAGCACTGGG No data
1179530916_1179530927 6 Left 1179530916 21:42019118-42019140 CCCACCAACACCTGGGGACCCGG No data
Right 1179530927 21:42019147-42019169 CCTCTCTTAAAGCACTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179530916 Original CRISPR CCGGGTCCCCAGGTGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr