ID: 1179535840

View in Genome Browser
Species Human (GRCh38)
Location 21:42051338-42051360
Sequence TTCTATTTGAATAAGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179535840_1179535845 10 Left 1179535840 21:42051338-42051360 CCATCATCCTTATTCAAATAGAA No data
Right 1179535845 21:42051371-42051393 AACCACGTTTTTTCCGGTTTAGG No data
1179535840_1179535844 4 Left 1179535840 21:42051338-42051360 CCATCATCCTTATTCAAATAGAA No data
Right 1179535844 21:42051365-42051387 CTTTGCAACCACGTTTTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179535840 Original CRISPR TTCTATTTGAATAAGGATGA TGG (reversed) Intergenic
No off target data available for this crispr