ID: 1179537000

View in Genome Browser
Species Human (GRCh38)
Location 21:42059305-42059327
Sequence CACCCTTGGAAGCCCTGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179536997_1179537000 4 Left 1179536997 21:42059278-42059300 CCTCAACGCTGGCCAGCTACTGC No data
Right 1179537000 21:42059305-42059327 CACCCTTGGAAGCCCTGACCTGG No data
1179536998_1179537000 -8 Left 1179536998 21:42059290-42059312 CCAGCTACTGCTGAACACCCTTG No data
Right 1179537000 21:42059305-42059327 CACCCTTGGAAGCCCTGACCTGG No data
1179536996_1179537000 12 Left 1179536996 21:42059270-42059292 CCTGCTTGCCTCAACGCTGGCCA No data
Right 1179537000 21:42059305-42059327 CACCCTTGGAAGCCCTGACCTGG No data
1179536994_1179537000 23 Left 1179536994 21:42059259-42059281 CCACGCTGTCACCTGCTTGCCTC No data
Right 1179537000 21:42059305-42059327 CACCCTTGGAAGCCCTGACCTGG No data
1179536993_1179537000 26 Left 1179536993 21:42059256-42059278 CCACCACGCTGTCACCTGCTTGC No data
Right 1179537000 21:42059305-42059327 CACCCTTGGAAGCCCTGACCTGG No data
1179536992_1179537000 27 Left 1179536992 21:42059255-42059277 CCCACCACGCTGTCACCTGCTTG No data
Right 1179537000 21:42059305-42059327 CACCCTTGGAAGCCCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179537000 Original CRISPR CACCCTTGGAAGCCCTGACC TGG Intergenic
No off target data available for this crispr