ID: 1179537518

View in Genome Browser
Species Human (GRCh38)
Location 21:42062016-42062038
Sequence GGGAAGGCCAATTTGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179537518_1179537526 13 Left 1179537518 21:42062016-42062038 CCTCAGGACAAATTGGCCTTCCC No data
Right 1179537526 21:42062052-42062074 GGCAGGCAGAGAATCTAGGTTGG No data
1179537518_1179537527 14 Left 1179537518 21:42062016-42062038 CCTCAGGACAAATTGGCCTTCCC No data
Right 1179537527 21:42062053-42062075 GCAGGCAGAGAATCTAGGTTGGG No data
1179537518_1179537525 9 Left 1179537518 21:42062016-42062038 CCTCAGGACAAATTGGCCTTCCC No data
Right 1179537525 21:42062048-42062070 TCGCGGCAGGCAGAGAATCTAGG No data
1179537518_1179537528 21 Left 1179537518 21:42062016-42062038 CCTCAGGACAAATTGGCCTTCCC No data
Right 1179537528 21:42062060-42062082 GAGAATCTAGGTTGGGACCCTGG No data
1179537518_1179537521 -4 Left 1179537518 21:42062016-42062038 CCTCAGGACAAATTGGCCTTCCC No data
Right 1179537521 21:42062035-42062057 TCCCCACGTGAACTCGCGGCAGG No data
1179537518_1179537519 -8 Left 1179537518 21:42062016-42062038 CCTCAGGACAAATTGGCCTTCCC No data
Right 1179537519 21:42062031-42062053 GCCTTCCCCACGTGAACTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179537518 Original CRISPR GGGAAGGCCAATTTGTCCTG AGG (reversed) Intergenic