ID: 1179537521

View in Genome Browser
Species Human (GRCh38)
Location 21:42062035-42062057
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179537518_1179537521 -4 Left 1179537518 21:42062016-42062038 CCTCAGGACAAATTGGCCTTCCC No data
Right 1179537521 21:42062035-42062057 TCCCCACGTGAACTCGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179537521 Original CRISPR TCCCCACGTGAACTCGCGGC AGG Intergenic