ID: 1179537920

View in Genome Browser
Species Human (GRCh38)
Location 21:42064101-42064123
Sequence CTGATTCACCAGCAGCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179537920_1179537924 -2 Left 1179537920 21:42064101-42064123 CCCCAAGGCTGCTGGTGAATCAG 0: 1
1: 1
2: 1
3: 12
4: 157
Right 1179537924 21:42064122-42064144 AGATCCCTGGCGTTCTCCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 49
1179537920_1179537928 26 Left 1179537920 21:42064101-42064123 CCCCAAGGCTGCTGGTGAATCAG 0: 1
1: 1
2: 1
3: 12
4: 157
Right 1179537928 21:42064150-42064172 CAGCCCAACAGTTTCTCTGCCGG 0: 1
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179537920 Original CRISPR CTGATTCACCAGCAGCCTTG GGG (reversed) Intronic
900424988 1:2573322-2573344 CTGTCTCACCTGCAGACTTGAGG - Intergenic
902970792 1:20047044-20047066 CTGAGTAACCAGGGGCCTTGTGG + Intronic
903916538 1:26768835-26768857 CTGATCCAACAGCAGGCTTCTGG - Intronic
904914865 1:33962498-33962520 CTGATTTACAAGGAACCTTGAGG + Intronic
905421708 1:37850665-37850687 CAGAATGACCAGCGGCCTTGTGG + Intronic
907448360 1:54524856-54524878 CTGCGTCAGCAGCAGACTTGCGG - Intergenic
908985764 1:70018788-70018810 ATGTTTCCCCAGCAGCCTCGTGG + Exonic
912521225 1:110246149-110246171 CTGATACTCTGGCAGCCTTGAGG - Intronic
914863058 1:151402296-151402318 CTGATGCCCCAGCTGACTTGAGG - Intergenic
919284738 1:195541972-195541994 CTGAAACACCAGCACTCTTGGGG + Intergenic
919835294 1:201569115-201569137 CAGAACCACCAGCAGCCCTGAGG + Intergenic
921355092 1:214278610-214278632 CTGATCTGCCAGCAGCATTGTGG - Intergenic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
1064585660 10:16837229-16837251 CTGGTTCTCCAGCAGCCTCCTGG + Intronic
1065184107 10:23155910-23155932 CTCGGTCAGCAGCAGCCTTGTGG + Intergenic
1065897569 10:30177747-30177769 CTCATTCAGCAGCAGCAGTGGGG + Intergenic
1067063865 10:43092801-43092823 CTAGTGCACCAGCAACCTTGTGG - Intronic
1069990167 10:72310332-72310354 CTGAATCAGCGGGAGCCTTGCGG + Intergenic
1071424192 10:85531919-85531941 ATTATTCACCAGCAGCCTCAGGG - Intergenic
1072628162 10:97127748-97127770 CGGAGAAACCAGCAGCCTTGGGG + Intronic
1075485998 10:122822421-122822443 CTGAGGCAGCCGCAGCCTTGGGG + Intergenic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1075912545 10:126137735-126137757 CTGAATCACCTTCTGCCTTGTGG + Intronic
1076482686 10:130795225-130795247 TAGGTTCACCAGCAGCCTGGAGG + Intergenic
1077887156 11:6394721-6394743 CTGTTTCCCCGGCATCCTTGGGG - Exonic
1078423321 11:11229879-11229901 ATGACTCACCTACAGCCTTGAGG + Intergenic
1080736481 11:35020762-35020784 CTAATTCAACATTAGCCTTGTGG + Intergenic
1081963660 11:47156457-47156479 CTGACTCATCAGCAGCTTTCAGG + Intronic
1083061539 11:59877876-59877898 CTCCTTCATCAGCAGCCCTGAGG + Intergenic
1087119065 11:94553974-94553996 CTGGTTTACCAGGAGGCTTGTGG + Intronic
1087453483 11:98353662-98353684 CTGACTCTCCAGCCCCCTTGTGG - Intergenic
1091583743 12:1804412-1804434 CTTATTCACCAACAACCCTGTGG + Intronic
1091630706 12:2158584-2158606 CTGATTTACCCGCAGCCATGTGG + Intronic
1092096943 12:5850536-5850558 CTGTTTTATCTGCAGCCTTGGGG + Intronic
1092243463 12:6849833-6849855 CTGTTTCACCAGTGGGCTTGGGG + Exonic
1092591682 12:9957994-9958016 CTTCTTCATGAGCAGCCTTGAGG - Intronic
1093865940 12:24227585-24227607 CTGATTCACCTGCATTCTTTTGG + Intergenic
1095487353 12:42699040-42699062 CTGCATCGCCAGCAGACTTGTGG - Intergenic
1095546132 12:43372638-43372660 ATGATTCAGCAGCAGAATTGAGG + Intronic
1099389276 12:82059203-82059225 CTGATTCAGCAGCAGATGTGAGG + Intergenic
1100884160 12:99051037-99051059 CTGATCCACCACCACCCATGAGG - Intronic
1102540602 12:113616507-113616529 CTTTATCACCAGCAGCCTTCTGG - Intergenic
1104982740 12:132581551-132581573 CTGGTTCCTCAGCAGCCTTGTGG + Intronic
1107708887 13:43133253-43133275 CTGTTTCTCCAGCAGACATGGGG - Intergenic
1113245225 13:108387923-108387945 CTGGTTCAACAGTGGCCTTGGGG + Intergenic
1115360354 14:32493629-32493651 CAGAGTGACCAGCAGCCCTGAGG - Intronic
1119352365 14:73976528-73976550 GACATTCACCTGCAGCCTTGGGG - Intronic
1121786939 14:96668998-96669020 TTGATTCCCCAGCAGCCTCATGG - Intergenic
1125082047 15:35686166-35686188 CTGACTCTGCAGCAGCCTTCGGG - Intergenic
1126464345 15:48947588-48947610 CTCATTCACCAGGATCCTGGAGG + Intronic
1126638308 15:50800938-50800960 CTGTTTCACCCACAGCTTTGGGG - Intergenic
1130025703 15:80268809-80268831 CTGACTCAGGAGCAGGCTTGAGG + Intergenic
1131177246 15:90217755-90217777 CTCATTCCCCAGCTGCTTTGGGG + Exonic
1131729097 15:95260279-95260301 CTTTTTCACCAGCAGGCTTGAGG - Intergenic
1132404041 15:101531459-101531481 GTGACTCTCCTGCAGCCTTGGGG + Intergenic
1132736339 16:1387928-1387950 CTGACCCACCAGTAGCCTAGAGG + Intronic
1134231246 16:12432301-12432323 CTGGTTCTCCAGAAACCTTGTGG + Intronic
1134435238 16:14250737-14250759 GGGATTCTGCAGCAGCCTTGCGG - Intronic
1138698390 16:58837392-58837414 CTGATTCTCCCTCAGCCCTGGGG + Intergenic
1140421217 16:74821004-74821026 CTGATTCTCATGCAGCCTTGGGG + Intergenic
1142225235 16:88873932-88873954 CTGTCTCACCCTCAGCCTTGTGG + Intergenic
1142427618 16:90009016-90009038 GTGGTTCACCCACAGCCTTGTGG - Intronic
1144993117 17:19247661-19247683 CTGATGAGACAGCAGCCTTGGGG + Intronic
1147426759 17:40349486-40349508 CTGACTCACCAGCAGCCCTGAGG + Intronic
1148876383 17:50689846-50689868 TTCATTCACCAGCAGCCCTAGGG + Intronic
1150595974 17:66605022-66605044 ATTATTCACAAGGAGCCTTGGGG - Intronic
1151404045 17:73875389-73875411 CTGCTTCTCCAGCAGACTTGGGG + Intergenic
1151734104 17:75928067-75928089 CTGACCCACCTGCAGGCTTGGGG + Exonic
1152788081 17:82262265-82262287 CTGCTTCAGCAGTAGCCTGGGGG + Intronic
1157392052 18:47311143-47311165 CTAATGCACCGGGAGCCTTGTGG + Intergenic
1160993444 19:1871112-1871134 CTGATTCTCCAGCAGCCTCAGGG - Intergenic
1161267514 19:3371286-3371308 CTGAATCTGCAGCAGCCCTGAGG - Intronic
1162522833 19:11192214-11192236 CTGGTAAACCAACAGCCTTGGGG + Intronic
1165161876 19:33821095-33821117 CTGATGCAAGAGAAGCCTTGAGG - Intergenic
1165168431 19:33872954-33872976 CTGAGTCACCAGCTCCCTTTAGG - Intergenic
926105085 2:10144971-10144993 CTGATTCCCCAGCAGCCTTGGGG - Intronic
926633112 2:15155563-15155585 CTGATTCCCTGGAAGCCTTGAGG - Intergenic
927875283 2:26651084-26651106 CTGATTCATGAGCAGCATGGGGG + Intergenic
930729113 2:54710299-54710321 CTGGTCTAGCAGCAGCCTTGCGG + Intergenic
932048208 2:68371408-68371430 CTGGTTTACCTGCAGCTTTGAGG + Intronic
937594490 2:123657540-123657562 CTAAGTCACCAGCAGGTTTGGGG + Intergenic
946137173 2:217656928-217656950 CTGCTTCTGCAGCAGCCTTCAGG - Intronic
946283047 2:218680247-218680269 CTGATTCATCAGGAAACTTGGGG + Intronic
946708403 2:222482090-222482112 CTACTTCACCAGCAGCTTTGAGG + Intronic
948394237 2:237632644-237632666 TTGGTTCTCCAACAGCCTTGAGG - Intronic
948640173 2:239370694-239370716 CTGGTGCACCTGCAGCCCTGCGG + Intronic
1168924452 20:1567612-1567634 CCCATTCACCACCAGCCCTGGGG - Intronic
1170332303 20:15227029-15227051 TTGATTCACCTCCAGCTTTGTGG + Intronic
1172385160 20:34529061-34529083 AGGATTTACCAGCAGCCCTGTGG + Intronic
1172871075 20:38135893-38135915 CTGATGCGCCCGCAGCCGTGAGG - Intronic
1176264822 20:64203649-64203671 CTGGCTCAACAGCAGCCATGGGG - Intronic
1179245520 21:39630815-39630837 ATGTTTCCCCAGCAGCCTTCAGG + Intronic
1179537920 21:42064101-42064123 CTGATTCACCAGCAGCCTTGGGG - Intronic
1181405154 22:22679174-22679196 CTGAATCAGCAGCAACATTGGGG + Intergenic
1181408310 22:22700818-22700840 CTGAATCAGCAGCAACATTGAGG + Intergenic
1181413630 22:22744131-22744153 CTGAATCAACAGCAGTATTGGGG + Intronic
1181657474 22:24315454-24315476 TTGCCTCACCACCAGCCTTGTGG - Intronic
1181712369 22:24698554-24698576 TCGATTCACCAGCTGCCTAGGGG - Intergenic
1183095294 22:35548399-35548421 CTGACTCAACAGAAGACTTGGGG - Intronic
1183831285 22:40419496-40419518 CTAATCCTCCAGCAGCCTGGAGG + Intronic
1183927555 22:41216942-41216964 CTGATCCACCAGTGGCCATGAGG - Intronic
949111248 3:263209-263231 CTAAATCACCAGCAGTCTCGGGG - Intronic
950692035 3:14666651-14666673 TTGATTTTCCAGCAGTCTTGTGG + Intronic
951249298 3:20375606-20375628 CTGTTTCACAATCAGCCCTGGGG - Intergenic
952057653 3:29468303-29468325 CAGATTCCCCAGAAGGCTTGCGG + Intronic
953472822 3:43181357-43181379 GTGATTAAACCGCAGCCTTGGGG + Intergenic
953863124 3:46562209-46562231 ATGATGCTCAAGCAGCCTTGTGG + Intronic
956856579 3:73280984-73281006 CTGCTTCCCGAGCAGCCTTCTGG - Intergenic
959789875 3:110346746-110346768 CTTATTCACCAACCACCTTGTGG - Intergenic
959980819 3:112514920-112514942 CTGAGTGACCAGAGGCCTTGTGG - Intergenic
960203402 3:114865914-114865936 CTCATTCACCAGAAGGCTTTAGG - Intronic
960498462 3:118405985-118406007 CTAATTATCCAGCAGCCCTGAGG + Intergenic
961471250 3:127114585-127114607 CTAATGGACCAGCATCCTTGGGG - Intergenic
961657587 3:128451978-128452000 ATGTCTTACCAGCAGCCTTGGGG + Intergenic
963158097 3:142120899-142120921 CTGCTTTACCAGCAGCTCTGGGG + Intronic
963969277 3:151411431-151411453 CAGATTCAGCAGCAGCCGAGTGG + Exonic
964548934 3:157865490-157865512 CTGCTTCTCCAGCTGCCTTCAGG + Intergenic
966819380 3:183913082-183913104 CTTATCCCCCAGCAGCCCTGTGG - Intergenic
967204666 3:187108609-187108631 CTGATTAACCAGGGGCCTAGAGG - Intergenic
968087259 3:195879381-195879403 CTTATTCACTTGCAGCCTGGTGG + Intronic
968510257 4:992420-992442 CTGCTCCCCCAGCAGACTTGGGG - Intronic
968803552 4:2758000-2758022 CTCATCCAACAACAGCCTTGGGG + Intergenic
970115397 4:12689035-12689057 CTGATTAACCTGAAGCCTTATGG - Intergenic
972488369 4:39563463-39563485 CTGATTCAGGAGCAGCTTCGGGG + Intronic
974016422 4:56653432-56653454 CTCATTCACCAGTACCCATGGGG + Intronic
974852765 4:67423510-67423532 CTGATTCACCACAATCCCTGTGG - Intergenic
975993378 4:80284526-80284548 GAGATTCACCAGTAGACTTGTGG + Intronic
978546819 4:109879431-109879453 CTGGTTCACCAGCTGCACTGAGG - Intergenic
982014260 4:151137475-151137497 CTGATTCACCAGTTGACCTGTGG + Intronic
984413661 4:179429471-179429493 CTGACTCACCAACTGTCTTGTGG - Intergenic
987645767 5:20671194-20671216 CCCATTCCCCAGCAGCCATGTGG + Intergenic
988067239 5:26237074-26237096 CAGATTCACCAGCAGGCTGCCGG - Intergenic
989673209 5:43944332-43944354 CTGAGGCATCAGCAGTCTTGGGG + Intergenic
992176066 5:74149787-74149809 TTGGTTCACCAGCAGCCATTTGG + Intergenic
999712748 5:154332836-154332858 CTGAAGCACCAGCTGCCCTGGGG + Intronic
1000999679 5:167994047-167994069 CTGACAGAGCAGCAGCCTTGGGG - Intronic
1002321250 5:178377407-178377429 CTGATTCTCCAGAAGCAGTGGGG - Intronic
1006828382 6:36953803-36953825 CTGATGCACCAGGAGCTCTGAGG - Intronic
1007127671 6:39441059-39441081 CTAAATCACAAGCATCCTTGTGG - Intronic
1015002681 6:128238423-128238445 CTCAGTCACCAGCTGCCTTGTGG - Intronic
1015638303 6:135302834-135302856 CTGATTGAACACCAGCCTTGGGG - Intronic
1015663839 6:135604571-135604593 CTGGTCCAGCCGCAGCCTTGTGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022468187 7:30665360-30665382 ATGAATCACCAGCAGGCATGTGG - Intronic
1024241685 7:47440611-47440633 CAGATTCTCCACCAGCCCTGTGG + Intronic
1024724404 7:52176289-52176311 CTGACTCTCCAGGTGCCTTGTGG + Intergenic
1024902124 7:54331543-54331565 CTACTTCAACAGCTGCCTTGAGG - Intergenic
1026290160 7:68998874-68998896 CTGGTTCAACAGAAGCCCTGAGG - Intergenic
1029094990 7:98077993-98078015 CTGATTCAGCAGCAGCTATAGGG - Intergenic
1030089947 7:105849670-105849692 ATGATTCACCAGGGGCCCTGAGG + Intronic
1030513953 7:110518744-110518766 CTGGTCCAGCTGCAGCCTTGTGG - Intergenic
1032012865 7:128358321-128358343 CTGACTCCCCACCAACCTTGGGG - Intronic
1033298181 7:140160423-140160445 CTGAATCAGCAGCTGCCCTGGGG + Intronic
1033434158 7:141317390-141317412 CTGATGCACCTGCAGCCAGGTGG - Intronic
1035674058 8:1442461-1442483 CTGAACCCCCAGCAGCCTGGCGG - Intergenic
1035674144 8:1442779-1442801 CTGAACCCCCAGCAGCCTGGTGG - Intergenic
1037918059 8:22784799-22784821 CTGATTCACTCGCCGCTTTGGGG + Intronic
1041803216 8:61822428-61822450 CTGATTCACCAAAACCCATGGGG - Intergenic
1048198903 8:132355229-132355251 CTGATTAACAAATAGCCTTGAGG - Intronic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049017782 8:139933138-139933160 CTGTTTCTCCAGCTGCCTTGAGG + Exonic
1049243143 8:141548827-141548849 CTGACCCACCAGCATCCATGAGG - Intergenic
1057132099 9:92661394-92661416 CTGAGTCACCAGCAGGCTCTGGG + Intronic
1057274470 9:93669091-93669113 TTGATTCACCAGCAACCCTGCGG + Intronic
1058958288 9:109969492-109969514 CTGCCAGACCAGCAGCCTTGGGG - Intronic
1060880638 9:127115884-127115906 ATGATTCACCATCAGCCCGGAGG + Intronic
1060945553 9:127568056-127568078 CGGCTTCCCCAGGAGCCTTGGGG + Intronic
1186543236 X:10422379-10422401 CTGATTTACAAGCAGTCTTCTGG + Intergenic
1194412221 X:93571278-93571300 CTGGGTGACCAGCGGCCTTGTGG - Intergenic
1195416238 X:104622531-104622553 CTAAGTCATCAGCAGCATTGTGG + Intronic
1195924956 X:110015937-110015959 CTGATTGACCCCCAGCCCTGTGG + Intronic
1196817782 X:119678681-119678703 CTGACTCCCCTGCAGCGTTGCGG - Intronic