ID: 1179543272

View in Genome Browser
Species Human (GRCh38)
Location 21:42098211-42098233
Sequence TCGTGGGGCTCTCTGGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179543272_1179543279 15 Left 1179543272 21:42098211-42098233 CCGGATCCCAGAGAGCCCCACGA 0: 1
1: 0
2: 4
3: 9
4: 134
Right 1179543279 21:42098249-42098271 TGTGTAGACAGAGGCACACTTGG 0: 1
1: 0
2: 0
3: 27
4: 725
1179543272_1179543278 6 Left 1179543272 21:42098211-42098233 CCGGATCCCAGAGAGCCCCACGA 0: 1
1: 0
2: 4
3: 9
4: 134
Right 1179543278 21:42098240-42098262 GCTGTTCACTGTGTAGACAGAGG 0: 1
1: 0
2: 0
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179543272 Original CRISPR TCGTGGGGCTCTCTGGGATC CGG (reversed) Intronic
900585440 1:3430398-3430420 CTGGAGGGCTCTCTGGGATCTGG - Intronic
902098042 1:13962458-13962480 ATGTGGGGCTCTCTGGGGCCAGG + Intergenic
902601064 1:17540320-17540342 CCTTGGGGGTCCCTGGGATCGGG + Intronic
902881590 1:19375110-19375132 TCGCGGGGCACTCTGGGAATGGG + Intronic
903226393 1:21896346-21896368 CCGTGGGGCTCAGTGGGAGCTGG - Intronic
907323074 1:53617962-53617984 TTGTGGGTCCCTCTGGGCTCAGG - Intronic
912948387 1:114103792-114103814 TGCTGGGGCGCTCTGGGGTCAGG + Intronic
912951303 1:114122535-114122557 ACGTGGGGCTGCCTGGGGTCTGG + Intronic
916043859 1:160983315-160983337 TTGTGGGTGTCTTTGGGATCTGG - Intergenic
920919283 1:210284880-210284902 TTGTAGGGCTCTCTGGGGTCTGG - Intergenic
1064597729 10:16962478-16962500 ACGTGGGGCTCACTGAGAGCTGG - Intronic
1067095630 10:43297707-43297729 TCGTGGGCCTCTCTTGGGGCAGG + Intergenic
1067793834 10:49306813-49306835 TGGTGGGTCCCCCTGGGATCTGG - Intronic
1072820185 10:98548945-98548967 TTGTGGGGCTCTGTGGGAACAGG - Intronic
1073485922 10:103819262-103819284 TCCTGGGGTTCCCTGGGAACAGG - Intronic
1074618300 10:115092927-115092949 TCGTGGGGCTCCCGGGGCGCGGG + Intergenic
1075495842 10:122917734-122917756 TCGTGGGGATCTCTAGCAGCTGG - Intergenic
1076237063 10:128871621-128871643 TCCAGGGGCTCTGTGGGATGGGG + Intergenic
1076372507 10:129964446-129964468 TCGCGGGGCTCGCGGGGCTCGGG - Intergenic
1077514116 11:2991704-2991726 TCGTGAGCCTCTGTGGGGTCAGG - Intronic
1078898844 11:15622737-15622759 TGGAGCTGCTCTCTGGGATCTGG - Intergenic
1081626843 11:44661174-44661196 TGGGGGGCCTCTCAGGGATCTGG - Intergenic
1083658170 11:64240201-64240223 TGGTGGGGCTAACTGGGCTCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084634505 11:70381876-70381898 TCCCGGGGCTCTTTGGGAGCTGG + Intronic
1090431168 11:126647871-126647893 TCATGGTGCTCTCCGGGGTCTGG + Intronic
1090465779 11:126931824-126931846 TCCTGGGGCTCCCTGGGTGCTGG - Intronic
1091405029 12:203738-203760 TGGTGGGGCTGTCTGGGAGAGGG + Intronic
1091781324 12:3216155-3216177 CCCTGGGGCCCTCTGGGAGCTGG + Intronic
1095599686 12:44000931-44000953 TAGTGAGGACCTCTGGGATCTGG - Intronic
1096525974 12:52210732-52210754 TCCTGGGTCTCTCTGGGCCCTGG + Intergenic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1097919155 12:65052918-65052940 TTGTGGGGATCACTGGGATCTGG + Intronic
1102385320 12:112504157-112504179 TCCTGGTGCTCCCTGGGGTCTGG - Intronic
1102454843 12:113065068-113065090 TCGTGGGGCCCACTGGGGCCTGG + Intronic
1108484653 13:50911168-50911190 TCCTGGGGCTATCTAGGAACAGG - Intronic
1109798280 13:67343820-67343842 TCTTGGGGATGTATGGGATCTGG + Intergenic
1113025750 13:105939021-105939043 GCCTGGGGCTCTCTGGGCACTGG + Intergenic
1114210101 14:20606813-20606835 TGGTGGGCGTCTTTGGGATCTGG + Intronic
1121227098 14:92328950-92328972 TCCTGGGGCTTTCTGTGATAAGG + Intronic
1123706695 15:22955787-22955809 TCCAGGGTCTCTCTGGGAACTGG - Intronic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1128290817 15:66477028-66477050 TTGTGAGGCCCTCCGGGATCTGG + Intronic
1129303710 15:74642772-74642794 TCTGAGGGCTCTCTGGGAGCAGG + Intronic
1130253979 15:82317287-82317309 GCATGGGGCTCTCTGTGAGCCGG - Intergenic
1132544555 16:527376-527398 GCGTGGGGCTCGCGGGGAGCCGG - Intergenic
1134195532 16:12156527-12156549 TCATGGTGCTCTCTGGGGGCAGG - Intronic
1137564209 16:49523237-49523259 TCCTGGGGCTGTGTGGGAACAGG - Intronic
1141576075 16:84964201-84964223 TCATGGGGCGCAGTGGGATCTGG + Intergenic
1142468404 17:148555-148577 TCCTGGGCCTCTCTGGGGCCTGG + Intronic
1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG + Intronic
1146164015 17:30574252-30574274 TTGTTGGGCCCTCTGGGATATGG - Intergenic
1148805210 17:50260502-50260524 TCGTGGGGCTCTCTGCAGGCGGG + Intergenic
1150248785 17:63694714-63694736 TCCTCGGGCTCTCTGGGATCAGG - Exonic
1152725348 17:81942247-81942269 TCCTGGGGCTCGCGGGGGTCGGG + Intronic
1155584834 18:27352987-27353009 TCCTGGGGTTCTCCGTGATCAGG - Intergenic
1155595483 18:27481197-27481219 TAGTGTGGGTCTCAGGGATCTGG + Intergenic
1155618582 18:27749375-27749397 TCCTGGGTCACTCTGGGTTCCGG + Intergenic
1160049727 18:75421576-75421598 ACGTGGAGCTCTGTGGGGTCAGG + Intronic
1161260531 19:3335459-3335481 TTGGGGGGCTATCTGGGTTCAGG + Intergenic
1161325330 19:3660981-3661003 TCCGGGAGCTCTTTGGGATCCGG - Exonic
1162743194 19:12784706-12784728 TCGTGTGGCTCTCGGGGTGCTGG - Intronic
1162926216 19:13931719-13931741 TGCTGGGCCTCTCTAGGATCAGG + Intronic
1163575695 19:18109871-18109893 CCCTGGGGCTCTCTGGGAGCCGG - Intronic
1164579787 19:29427724-29427746 TAATGAGGCTCTCTGGGCTCAGG + Intergenic
1165027389 19:32971790-32971812 GCGTGGGGCTCTGTGGGGCCGGG - Intronic
1165342607 19:35223674-35223696 TTGGGGGGCTCCCTGGGACCTGG + Intergenic
1166780686 19:45340972-45340994 TCCTGGGGCTCTCCGGGATCTGG + Intronic
1166783491 19:45354243-45354265 TCGTGGGGCATTCTGGAAACAGG - Intronic
1166784993 19:45362412-45362434 CCGTGGGACTCTGTGGGATGTGG - Intronic
1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG + Intronic
925361523 2:3283609-3283631 TAGTGGTGCTCGCTGGTATCTGG - Intronic
925362025 2:3286380-3286402 TCCTGGGGCTTCCTGGAATCTGG - Intronic
927195083 2:20541384-20541406 ACGTGCTGCTCTCTGGGGTCTGG - Intergenic
927355426 2:22167549-22167571 ACTTTGGGCTCTCTGGGAGCTGG + Intergenic
928129912 2:28641970-28641992 TCGTGGGGCTTCCTGGGAGATGG - Intronic
931645457 2:64417766-64417788 TCGTGGGCATCTCAGGGATCTGG + Intergenic
932480208 2:72034592-72034614 TAGTGGGTCTCTCGGGGGTCAGG + Intergenic
932607432 2:73174817-73174839 CTGCGGGGCCCTCTGGGATCTGG - Intergenic
934892786 2:98085278-98085300 AGGTGGGTCTCTCTGGGATGGGG + Intergenic
937039611 2:118810757-118810779 TCATGGTGCTCTCTGAGGTCAGG - Intergenic
947518693 2:230828327-230828349 TCGGTGAGCTCCCTGGGATCTGG - Intergenic
947740875 2:232484321-232484343 TTGTGGGGCTGTCTGGGTCCTGG - Intronic
949035411 2:241813825-241813847 TCACGGGGCTCTCTGGGGACAGG - Intronic
949035428 2:241813884-241813906 TCACGGGGCTCTCTGGGGACAGG - Intronic
1170002613 20:11631868-11631890 TGGTGGGGCTCTCAGTGATGGGG + Intergenic
1173161549 20:40656398-40656420 TGTTGCAGCTCTCTGGGATCAGG - Intergenic
1173451908 20:43172224-43172246 TAGTGGAACTGTCTGGGATCTGG - Intronic
1175457654 20:59127472-59127494 CCGTGGGGCTGGCTGGGAACAGG - Intergenic
1177651165 21:23963871-23963893 TGGTGGGCATCTCTGGGCTCTGG - Intergenic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1181235811 22:21447022-21447044 ACGTGGGTCTCGCTGGGACCTGG + Exonic
1183060636 22:35334484-35334506 TCGGGTGGCTCTCGGGGTTCTGG + Intronic
1184272418 22:43392411-43392433 GCATGGGGCTCCCTGGGATCTGG + Intergenic
1184517050 22:44969096-44969118 TCGTGGAGCTCACTGGCATAGGG + Intronic
1184829429 22:46974863-46974885 TCGTGTTGCTCTCTGGGAGCAGG - Intronic
1184835819 22:47020272-47020294 TGGTGGGAGGCTCTGGGATCAGG + Intronic
1185247683 22:49781710-49781732 GCGTGGGGCCCTCAGGGCTCTGG - Intronic
949694941 3:6683388-6683410 TTCTGTGGCTTTCTGGGATCTGG - Intergenic
951578296 3:24135536-24135558 TCGGCTGGCTCTCTGGGAGCAGG + Intronic
952415846 3:33091295-33091317 TAGTGGGGTTCTGGGGGATCTGG - Exonic
953023493 3:39130914-39130936 TGGTGGGGAGCGCTGGGATCAGG - Intronic
953386539 3:42509480-42509502 ATGTGGGGTTCTCTGAGATCTGG - Intronic
953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG + Intergenic
959162973 3:102741683-102741705 TGGTGGGCATCTCTGGGCTCTGG + Intergenic
968549020 4:1213007-1213029 TCTTCAGGCTGTCTGGGATCCGG + Exonic
968949202 4:3681703-3681725 TGCTGGGGCTCTCTGCCATCTGG + Intergenic
969146155 4:5125844-5125866 TCGTGGGGGTCTGTGGGAGAGGG - Intronic
973058449 4:45689338-45689360 TGGTGGGCCTCTGTGAGATCTGG - Intergenic
975762138 4:77631025-77631047 TGGTGGGTGTCTCTGGGCTCTGG - Intergenic
984877725 4:184384611-184384633 TCGTGAGGCTGTCTGGCCTCTGG - Intergenic
987162816 5:15162097-15162119 TTATTGGGCTCTATGGGATCTGG - Intergenic
988503012 5:31799177-31799199 ACGTGGGGCCCTGTGGGGTCTGG + Exonic
992106593 5:73453172-73453194 TCTTGGGGCTCCCAAGGATCAGG - Intergenic
992868665 5:80983385-80983407 TTGTGGGGCTCACTGGGATCTGG + Intronic
1003247604 6:4397570-4397592 TTGTGGAGCTGTCTGTGATCTGG - Intergenic
1006458359 6:34144510-34144532 TTGTGGGGGTCTCTAGGGTCTGG - Intronic
1006798767 6:36746406-36746428 TCGTGGGACACTCTGCCATCCGG + Exonic
1007380954 6:41489760-41489782 GCCTGGGTCTCTGTGGGATCAGG + Intergenic
1007606821 6:43123552-43123574 CCGTGTTGCTCTCTGGGCTCAGG - Intronic
1010395147 6:75383152-75383174 TGGAGGGGCTCTGTGGAATCAGG + Intronic
1012239284 6:96853858-96853880 TGGTGGGGCACTCTGGCATTTGG + Intergenic
1012421546 6:99071124-99071146 TGGTGGGCCTTTCTGGGCTCTGG + Intergenic
1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG + Exonic
1021845360 7:24757630-24757652 TCGTGTGACTCTCTGGGAGCCGG + Intronic
1023074938 7:36473188-36473210 TGGTGGGCATCTCTGGGCTCTGG - Intergenic
1031380019 7:121074178-121074200 TCATGGGGTTCTGTGTGATCAGG + Intronic
1031514867 7:122689156-122689178 TGGTGGGCATCTCTGGGCTCTGG - Intronic
1032079743 7:128852918-128852940 TGGTGGGGCCATCTGAGATCGGG + Exonic
1033929301 7:146504306-146504328 TGGTGGGTGTCTCTGGGCTCTGG - Intronic
1035356694 7:158280010-158280032 CCGCGGGGCTCTGTGGGTTCGGG - Intronic
1039211777 8:35224792-35224814 TCCAGGGACTTTCTGGGATCTGG - Intergenic
1041005353 8:53492626-53492648 TCCAGGGGCTATCTGGTATCTGG + Intergenic
1044759855 8:95506699-95506721 TGGTGGGGTGCTCTGGCATCTGG - Intergenic
1047748083 8:127860154-127860176 TCCTGGAGCTCACTGGGAGCCGG - Intergenic
1048272201 8:133038420-133038442 ACGTGAGGCTCCCAGGGATCAGG + Exonic
1048632385 8:136258067-136258089 TGGTGGGACTCTTTGGGTTCTGG - Intergenic
1049587577 8:143439154-143439176 GGGTGGGCCTCTCTGGGGTCGGG - Intronic
1049644133 8:143728516-143728538 TCGTGGGCGTCCCTGGGGTCGGG - Exonic
1049771532 8:144384455-144384477 ACGTGGGTCTCCCTGGCATCTGG + Intronic
1050436032 9:5611835-5611857 GCGTGGGGCTCTATGGAACCCGG - Intergenic
1055336221 9:75236058-75236080 TGGTGGGCATCTCTGGGCTCTGG - Intergenic
1055351086 9:75389097-75389119 TCTTGGGTCTCTCTGGGCACAGG - Intergenic
1058774908 9:108273455-108273477 TTGTGAGGCTCTCTGGCTTCAGG - Intergenic
1060091718 9:120748772-120748794 TCGGGGGGCACTCTGTGACCAGG + Intergenic
1061504548 9:131024540-131024562 TCTTGGGGGTCTCTGGGACCAGG + Intronic
1198683615 X:139205508-139205530 GAGAAGGGCTCTCTGGGATCTGG + Intronic