ID: 1179544330

View in Genome Browser
Species Human (GRCh38)
Location 21:42104362-42104384
Sequence CCGCTGCCCAGAAGTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179544330_1179544337 -3 Left 1179544330 21:42104362-42104384 CCCCCAGCACTTCTGGGCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 321
Right 1179544337 21:42104382-42104404 CGGGACAACTGCCCACCTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1179544330_1179544336 -4 Left 1179544330 21:42104362-42104384 CCCCCAGCACTTCTGGGCAGCGG 0: 1
1: 0
2: 1
3: 15
4: 321
Right 1179544336 21:42104381-42104403 GCGGGACAACTGCCCACCTGTGG 0: 1
1: 0
2: 3
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179544330 Original CRISPR CCGCTGCCCAGAAGTGCTGG GGG (reversed) Intronic
900173568 1:1282027-1282049 AAGCTGCCCAGATGTGGTGGGGG + Intronic
900571725 1:3361931-3361953 CCGCGGCCCAGGAGGGCAGGTGG + Intronic
901887287 1:12231221-12231243 CAGCTGCCTAGAAGTCCTGATGG + Intronic
902704014 1:18191988-18192010 CCCCGGCCCAGGAGGGCTGGAGG - Intronic
903865244 1:26392955-26392977 AGGCTGCCCAGAAGAGCTAGTGG - Intergenic
903961869 1:27063023-27063045 CTGCTGTGCAGAATTGCTGGTGG + Intergenic
904310785 1:29628288-29628310 CCACTGGCCAGCAGTGTTGGAGG + Intergenic
912546932 1:110457584-110457606 ACGCTGCTCAGAAGGGTTGGGGG + Intergenic
912718546 1:112000453-112000475 CTGGTGCCAAGAAGTGCTGTGGG + Intergenic
914847885 1:151292823-151292845 CCTCAGCCCAGGAGTGGTGGGGG - Exonic
918751066 1:188270079-188270101 CTGCTGCCCAGAGCTGGTGGGGG - Intergenic
919699875 1:200620814-200620836 CCGCCCCCCGGAAGTGCCGGTGG + Intergenic
920150234 1:203900407-203900429 CCGGTGGCCAGCACTGCTGGGGG - Intergenic
920316073 1:205076446-205076468 TCTCTGCCCAGATGGGCTGGGGG + Exonic
922814733 1:228440385-228440407 CAGCTGGTCAGAAGTTCTGGAGG + Intergenic
1063525556 10:6781361-6781383 CAGCTGCTCAGATGTGCAGGAGG - Intergenic
1063541484 10:6938552-6938574 CAGCTGAGCAGAAGTGCAGGTGG + Intergenic
1065025087 10:21534083-21534105 CCGCCGCCGAGGTGTGCTGGGGG - Intergenic
1065199731 10:23301317-23301339 CCCCAACCCAGAAGTGTTGGGGG + Intronic
1066066303 10:31763537-31763559 CACCTGCCCAGAGGTTCTGGGGG - Intergenic
1067293014 10:44958210-44958232 CAACTGCCCAGGAGTGCTGGGGG + Intergenic
1067831846 10:49615036-49615058 CATCTGCCCAGGAGTGATGGAGG + Intronic
1068987488 10:63120711-63120733 CCCCAGCCCAGAAGTCCTTGGGG - Intergenic
1069375805 10:67791311-67791333 TCGCTGCCCAGATCTGATGGTGG - Intergenic
1070055939 10:72934686-72934708 CTGCTGCACAGAAGGGCTGGGGG - Intergenic
1070854209 10:79593642-79593664 CTGCAGCCCAGCAGTGATGGTGG - Intergenic
1070857249 10:79615735-79615757 CTGCAGCCCAGCAGTGATGGTGG + Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1072303102 10:94080855-94080877 CCACTGCCCAGACTTGCAGGTGG + Intronic
1072720900 10:97780552-97780574 CCACAGCCCAGAAGTGGTAGAGG - Intergenic
1073323300 10:102628489-102628511 CAGCTGCCCAGAAGCGCTTCCGG + Intronic
1073786306 10:106893823-106893845 CTGCTGGCCCGAAGAGCTGGAGG - Intronic
1074438072 10:113451653-113451675 CCTCAGCCTGGAAGTGCTGGTGG - Intergenic
1077234393 11:1472862-1472884 CCTGTGCCCAGAGATGCTGGAGG - Intronic
1077394110 11:2312746-2312768 CAGCTGCCCCAAAGGGCTGGGGG - Intronic
1077536589 11:3127598-3127620 CCCCTGACCCGGAGTGCTGGGGG + Intronic
1079238690 11:18707121-18707143 CCACAGCCCAGATGTGCAGGAGG - Exonic
1081115317 11:39192723-39192745 AGGCTGCACAGGAGTGCTGGTGG + Intergenic
1081623170 11:44631047-44631069 CCCCAGCCTAGAAGGGCTGGGGG + Intergenic
1083707276 11:64525208-64525230 CCTGTGCCCAGATGTGCGGGGGG - Intergenic
1084095428 11:66908094-66908116 CCACTGCTCACAAGTTCTGGTGG + Intronic
1084587444 11:70070884-70070906 CCCCTGCCCAGAACTGCTCGTGG + Intergenic
1084978682 11:72816934-72816956 CTGCTGCCCAGGGGTGGTGGGGG + Intronic
1085524295 11:77155301-77155323 ACGCTGCCCAGGATGGCTGGAGG + Intronic
1085810997 11:79680901-79680923 AAGCAGCTCAGAAGTGCTGGGGG + Intergenic
1087895618 11:103582618-103582640 CCACAGCCCAGAAGTGCTAGGGG - Intergenic
1089602887 11:119626015-119626037 CTGCTGCCCTGAAGGGCAGGGGG - Intronic
1090652553 11:128820265-128820287 CAGCTGCCCAGAAATTCTGAGGG + Intergenic
1091406710 12:213854-213876 CTGCTGCTCAGAGGGGCTGGAGG - Intronic
1091664533 12:2409829-2409851 CCGCTGCCCAGCAGGGGAGGTGG + Intronic
1091690035 12:2589633-2589655 CCTCTGCTCAGACGTTCTGGTGG - Intronic
1093700099 12:22210604-22210626 CAGCTGGTCAGAAGTTCTGGAGG - Intronic
1094126015 12:27022878-27022900 GCGCAGCCCACAAGTCCTGGCGG - Intronic
1095390588 12:41701322-41701344 CCACAGCCTCGAAGTGCTGGTGG - Intergenic
1096862534 12:54540205-54540227 CCGAGGCCCAGAAATGCTAGGGG + Intronic
1104672063 12:130687415-130687437 CCACCACCCAGATGTGCTGGGGG - Intronic
1109037724 13:57286795-57286817 CGGCAGGCCGGAAGTGCTGGCGG + Intergenic
1113866722 13:113531247-113531269 CCGCTGGCCAGACATGCTGATGG + Intronic
1113866730 13:113531291-113531313 CCGCGGGCCAGACGTGCTGATGG + Intronic
1116898671 14:50341164-50341186 CCGCTCCCCTGAGCTGCTGGTGG - Exonic
1119167150 14:72503904-72503926 GGGCTGCCCAGAAGAGCTGCAGG - Intronic
1119762515 14:77161399-77161421 CCTCAGGTCAGAAGTGCTGGCGG + Intronic
1120787588 14:88551322-88551344 CCGCGGCCCAGAAGGGGAGGCGG + Intronic
1120967666 14:90181967-90181989 CCACTGCCAAGAATTGCTGAGGG + Intronic
1121173965 14:91876646-91876668 CCACAGTCAAGAAGTGCTGGCGG + Intronic
1121518923 14:94572306-94572328 CCGCGGCCCCGAAGTGATGAAGG + Intronic
1122266138 14:100547770-100547792 ACTCTGCCCAGATGTGCTGTGGG + Intronic
1123717026 15:23040562-23040584 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717087 15:23040749-23040771 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717095 15:23040787-23040809 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717119 15:23040860-23040882 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717151 15:23040967-23040989 CAGCTGGCCGGAGGTGCTGGGGG + Intergenic
1123717167 15:23041011-23041033 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717175 15:23041049-23041071 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717188 15:23041086-23041108 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717198 15:23041122-23041144 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717254 15:23041311-23041333 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717312 15:23041499-23041521 CACCTGGCCAGAGGTGCTGGTGG + Intergenic
1123717320 15:23041537-23041559 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717331 15:23041574-23041596 CAGCTGGCCATAGGTGCTGGGGG + Intergenic
1123717341 15:23041611-23041633 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717359 15:23041683-23041705 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717382 15:23041757-23041779 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717427 15:23041908-23041930 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717525 15:23042234-23042256 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717538 15:23042272-23042294 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717559 15:23042345-23042367 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717583 15:23042417-23042439 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717621 15:23042532-23042554 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717629 15:23042570-23042592 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717662 15:23042680-23042702 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717671 15:23042715-23042737 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717705 15:23042822-23042844 CAGCTGGCCGGAGGTGCTGGGGG + Intergenic
1123717723 15:23042903-23042925 CACCTGGCCAGAGGTGCTGGAGG + Intergenic
1123717736 15:23042940-23042962 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717761 15:23043012-23043034 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717770 15:23043048-23043070 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717808 15:23043162-23043184 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717816 15:23043200-23043222 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717896 15:23043463-23043485 CAGCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717920 15:23043572-23043594 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123717943 15:23043646-23043668 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718001 15:23043835-23043857 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718041 15:23043978-23044000 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718049 15:23044016-23044038 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718074 15:23044089-23044111 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718097 15:23044161-23044183 CAGCTGGCCGGAAGTGCTGGGGG + Intergenic
1123718111 15:23044204-23044226 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718119 15:23044242-23044264 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718141 15:23044315-23044337 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718173 15:23044422-23044444 CAGCTGGCCGGAGGTGCTGGGGG + Intergenic
1123718198 15:23044504-23044526 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718248 15:23044684-23044706 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718261 15:23044722-23044744 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718346 15:23045046-23045068 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718355 15:23045081-23045103 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718389 15:23045188-23045210 CAGCTGGCCGGAGGTGCTGGGGG + Intergenic
1123718408 15:23045269-23045291 CACCTGGCCAGAGGTGCTGGAGG + Intergenic
1123718421 15:23045306-23045328 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718444 15:23045379-23045401 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718453 15:23045415-23045437 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718475 15:23045486-23045508 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718492 15:23045530-23045552 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718500 15:23045568-23045590 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718512 15:23045604-23045626 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718519 15:23045640-23045662 CAGCTGGCCAGAGGTGCTAGAGG + Intergenic
1123718577 15:23045832-23045854 CAGTTGGCCAGAGGTGCTGGGGG + Intergenic
1123718601 15:23045941-23045963 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718624 15:23046015-23046037 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718651 15:23046121-23046143 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718675 15:23046193-23046215 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718683 15:23046231-23046253 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718716 15:23046341-23046363 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718725 15:23046376-23046398 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718758 15:23046483-23046505 CAGCTGGCCGGAGGTGCTGGGGG + Intergenic
1123718779 15:23046564-23046586 CACCTGGCCAGAGGTGCTGGAGG + Intergenic
1123718792 15:23046601-23046623 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718821 15:23046710-23046732 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718860 15:23046825-23046847 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718879 15:23046900-23046922 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718927 15:23047081-23047103 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718952 15:23047154-23047176 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123718982 15:23047261-23047283 CAGCTGGCCGGAGGTGCTGGGGG + Intergenic
1123719008 15:23047343-23047365 CATCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719062 15:23047531-23047553 CACCTGGCCAGAGGTGCTGGTGG + Intergenic
1123719070 15:23047569-23047591 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719081 15:23047606-23047628 CAGCTGGCCATAGGTGCTGGGGG + Intergenic
1123719091 15:23047643-23047665 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719166 15:23047897-23047919 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719198 15:23048004-23048026 CAGCTGGCCGGAGGTGCTGGGGG + Intergenic
1123719219 15:23048086-23048108 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719230 15:23048123-23048145 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719240 15:23048159-23048181 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719273 15:23048266-23048288 CAGCTGGCCGGAGGTGCTGGGGG + Intergenic
1123719298 15:23048348-23048370 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719353 15:23048536-23048558 CACCTGGCCAGAGGTGCTGGTGG + Intergenic
1123719361 15:23048574-23048596 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719372 15:23048611-23048633 CAGCTGGCCATAGGTGCTGGGGG + Intergenic
1123719382 15:23048648-23048670 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719402 15:23048722-23048744 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719437 15:23048829-23048851 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719454 15:23048873-23048895 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719473 15:23048948-23048970 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719559 15:23049245-23049267 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719570 15:23049283-23049305 CACCTGGCCAGAGGTGCTGGTGG + Intergenic
1123719614 15:23049430-23049452 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719666 15:23049610-23049632 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719770 15:23050009-23050031 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719781 15:23050044-23050066 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719790 15:23050079-23050101 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719875 15:23050332-23050354 CGCCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719883 15:23050367-23050389 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719902 15:23050437-23050459 CACCTGGCCAGAGGTGCTGGGGG + Intergenic
1123719911 15:23050472-23050494 CACCTGGCCAGAGGTGCTGGAGG + Intergenic
1124353681 15:28979052-28979074 TATCTTCCCAGAAGTGCTGGAGG + Intronic
1127088423 15:55445794-55445816 CCGCTTCCCAGATGGGGTGGCGG + Intronic
1127088499 15:55446056-55446078 CCGCTTCCCAGATGGGGTGGCGG + Intronic
1128282602 15:66408846-66408868 CCGCTGCCCAGATGGGGTGGAGG - Intronic
1128920652 15:71607163-71607185 TCTCTGACCAGAAGTGGTGGAGG + Intronic
1131179096 15:90228136-90228158 CTACTGCCCAGAGGTGGTGGAGG + Exonic
1132589830 16:721788-721810 TCGGTGCCCACAGGTGCTGGCGG + Exonic
1132995516 16:2820488-2820510 CCGCCTCCCAGGGGTGCTGGGGG + Intronic
1135733507 16:24913320-24913342 CCCCTTCCCAGGAGGGCTGGGGG - Intergenic
1142247394 16:88976320-88976342 CCGCAGCCGGGAAGTGATGGGGG - Intronic
1142380423 16:89728954-89728976 CAGCGGCCCAGAAGGGGTGGAGG - Intronic
1142638695 17:1272489-1272511 CCAGAGCCCAGAGGTGCTGGGGG + Intergenic
1144496511 17:15749507-15749529 CCCCTGCCCAGGACTCCTGGTGG + Intergenic
1145235926 17:21208410-21208432 CCACTGCCAAGAAGAGCGGGAGG + Intronic
1145969888 17:28950575-28950597 CCGGTACCCGGACGTGCTGGGGG + Intronic
1146271422 17:31488109-31488131 CTGGTGCCCAGAAGTGCGAGCGG + Intronic
1146693492 17:34892550-34892572 CCGTTGCCCAGAAATGCATGAGG - Intergenic
1147230848 17:39016682-39016704 CTGTTGGCCAGAAGTTCTGGAGG + Intergenic
1147683948 17:42276114-42276136 CCGCGGCCCGGGAGTGATGGCGG + Intronic
1147738379 17:42655407-42655429 CTGCTGGTCAGAAGTTCTGGAGG + Intergenic
1149545095 17:57497466-57497488 CAGCTCCCCAGCACTGCTGGAGG - Intronic
1149863181 17:60135647-60135669 CCGCGGCCCTAAGGTGCTGGCGG - Intergenic
1151473671 17:74333058-74333080 CCCGAGCCCAGAAGTGCTGCGGG + Intronic
1152028568 17:77827237-77827259 CCCCTTCCCAGCAGTTCTGGGGG - Intergenic
1153976693 18:10274488-10274510 GAGCTGCCCAGAAGAGCTGCTGG - Intergenic
1154047134 18:10916472-10916494 TGGCGGCCCAGGAGTGCTGGGGG + Intronic
1154294605 18:13137456-13137478 CCGATGCACAGAAGCGCAGGTGG + Intergenic
1154490201 18:14916205-14916227 CTGCAGCCCAGAACTGTTGGTGG - Intergenic
1157833501 18:50878787-50878809 CCCCGGGCCAGGAGTGCTGGGGG + Intergenic
1158629094 18:59096460-59096482 CAGGTGCCCAGAAGTGCAGTGGG + Intergenic
1159355925 18:67337409-67337431 CATCTGCTCAGAAGTGGTGGAGG + Intergenic
1159566101 18:70051939-70051961 CCCCTGCCCAAAGCTGCTGGAGG - Intronic
1161073539 19:2274073-2274095 GCGCTGCCCAAATGAGCTGGGGG - Intronic
1161365657 19:3877903-3877925 CCCCTGCACAAAAGAGCTGGTGG + Intergenic
1161366131 19:3880813-3880835 CCCCTGCACAAAAGAGCTGGCGG + Exonic
1161943769 19:7421826-7421848 CCTCTGCTCAGAAGTCCTGAAGG - Intronic
1162352231 19:10157834-10157856 CCGCTGCACAGGTGGGCTGGAGG + Intronic
1162824430 19:13243035-13243057 CAGCTCCCCAGAAGGGCAGGTGG - Intronic
1164618884 19:29682136-29682158 GGGCTGCCCAGAAGTGCCCGAGG + Intergenic
1165828406 19:38718681-38718703 TCACTTCCCTGAAGTGCTGGAGG - Intronic
1165920180 19:39292379-39292401 CCTCTCTCCAGAAGTGCTCGAGG - Intergenic
1166385147 19:42376507-42376529 TCGCAGCCCAGCAGTGGTGGCGG - Exonic
925822120 2:7809855-7809877 CTGCAGCCAAGAAGTGATGGGGG - Intergenic
926783531 2:16497956-16497978 CTGCAGCCCAGAGGTGGTGGGGG + Intergenic
932075962 2:68663248-68663270 TAGCTGCCCAGTAGTGGTGGGGG - Intergenic
932485586 2:72082394-72082416 GTGCTGCACAGAAGTGCTGACGG - Intergenic
932494381 2:72139177-72139199 CGGCTGCCCAGGAGGGGTGGGGG + Intronic
933834054 2:86231710-86231732 CAGCTGCCCAGGACTGATGGTGG - Intronic
934105550 2:88691747-88691769 CCGCTGCCCGGGAGGGCCGGGGG + Exonic
934210824 2:89976973-89976995 CAGCTCCCCTGCAGTGCTGGGGG - Intergenic
936464885 2:112738945-112738967 CCGCTACCCAGAAATGCTGCAGG - Exonic
937156254 2:119721548-119721570 CAGCTGGTCAGAAATGCTGGTGG + Intergenic
937306367 2:120873987-120874009 CTGCTGCCCCCAAGTCCTGGGGG + Intronic
938388001 2:130881698-130881720 CTGTGGCTCAGAAGTGCTGGAGG + Intronic
941790447 2:169547050-169547072 CGGTTGCTCAGAAGTTCTGGAGG - Intronic
942244950 2:173999278-173999300 GTGCTGCCCAGGAGTGCTGCTGG - Intergenic
942438132 2:176002791-176002813 CCGGTCCCCAGGAGTGCTTGAGG + Intronic
944063684 2:195596464-195596486 CCGTTGCCCACAAGTGCTGTGGG + Intronic
946688537 2:222294407-222294429 CCGCTGCCCTGCACTGCTCGCGG + Intronic
947977042 2:234375810-234375832 CAGCAGCCCAGCCGTGCTGGGGG + Intergenic
948427762 2:237898654-237898676 CTTCTGCCCAGCACTGCTGGAGG - Intronic
1169472980 20:5904344-5904366 CTGCTTCTCACAAGTGCTGGAGG + Intergenic
1170724546 20:18914692-18914714 CAGCTGGTCAGAAGTTCTGGTGG + Intergenic
1170798255 20:19569146-19569168 GTGCCTCCCAGAAGTGCTGGGGG - Intronic
1170991240 20:21303513-21303535 CCGCGGCCTAGACGTGCCGGGGG - Intronic
1174393843 20:50234028-50234050 CGGCTGCCAAGGAGAGCTGGAGG + Intergenic
1175446833 20:59027006-59027028 CAGCTACCCAGCACTGCTGGAGG + Exonic
1177819102 21:26011675-26011697 CTGCTGCCCAGTAGTCTTGGTGG - Intronic
1178480269 21:32974281-32974303 CAGCTCCCCAGAAGGGCTGAAGG - Intergenic
1178891545 21:36524722-36524744 CCACTTCCCAGCAGGGCTGGTGG + Intronic
1178978221 21:37238997-37239019 GCGCTGCCCAGAAGAGCACGGGG - Intronic
1179544330 21:42104362-42104384 CCGCTGCCCAGAAGTGCTGGGGG - Intronic
1180958817 22:19753546-19753568 CTGCTGCCCAGAGGAACTGGAGG + Intergenic
1181491259 22:23262264-23262286 CGGTAGTCCAGAAGTGCTGGGGG - Intronic
1181768831 22:25111443-25111465 TCGCTGCCCAGGAATGCAGGAGG - Intronic
1182106248 22:27691827-27691849 CCACAGCCAACAAGTGCTGGGGG + Intergenic
1182121577 22:27790660-27790682 CCGCTTCCCACAACTGGTGGGGG + Intronic
1184215906 22:43067114-43067136 CAGCTGCTCAGAAGTGCCCGGGG - Intronic
1185148949 22:49153466-49153488 CCGGTGCCCAGAAGACCTGCGGG + Intergenic
1185213081 22:49582966-49582988 CCTCTGCCCAGTGGTCCTGGAGG - Intronic
951949711 3:28186315-28186337 GCGCAGACTAGAAGTGCTGGGGG + Intergenic
952929347 3:38347208-38347230 CCGGTGCCCAGAGGGGCCGGAGG + Intronic
953492809 3:43364662-43364684 CCAGTGGCCAGAAGGGCTGGGGG + Intronic
955060482 3:55488331-55488353 CAGTTGGCCAGAAGGGCTGGGGG - Intronic
955132749 3:56187191-56187213 TTCCTGTCCAGAAGTGCTGGGGG - Intronic
959070052 3:101693704-101693726 GCCCTGCCCTGTAGTGCTGGGGG - Intergenic
960765723 3:121127813-121127835 CTGCTGACCAGAAGTGTTTGAGG - Intronic
962638861 3:137361954-137361976 CTGCTGCCTAGAATTGCGGGAGG + Intergenic
965586984 3:170327595-170327617 CGGCGGGCCAGCAGTGCTGGAGG - Intergenic
967164955 3:186772496-186772518 CCGCCGCCCACAAGGGCTGGGGG - Intergenic
967272092 3:187740456-187740478 CCGCTCCCCAGCAGTCTTGGAGG - Intronic
968964613 4:3763663-3763685 CCACTGCCCAGGAGGGCTGAAGG - Intergenic
969647463 4:8440870-8440892 CCGCAGCCCAGAAGCCCTGTGGG - Exonic
975016877 4:69432619-69432641 CAGCTGCCTAGAAGTGCGAGGGG + Intergenic
976179739 4:82387552-82387574 CAGTTGGCCAGAGGTGCTGGAGG + Intergenic
985478506 5:92555-92577 CGGGTACCCAGACGTGCTGGGGG + Intergenic
985748463 5:1661089-1661111 GCGCTGGCCAGAAGCGCAGGTGG + Intergenic
986572908 5:9183360-9183382 CTGCAGCCCAGAAGTGCAGGAGG - Intronic
989135721 5:38152378-38152400 CCTCTTCCCAGAAATGCTGTTGG - Intergenic
989624436 5:43415771-43415793 CAGCTGTTCAGAAGTTCTGGAGG + Intergenic
990435448 5:55785857-55785879 ACACTGACCAGAATTGCTGGTGG - Exonic
992198300 5:74361120-74361142 CCTCAGCTCAGAAGGGCTGGAGG - Intergenic
995653017 5:114392607-114392629 CCTCAGCCCAGAACTGCAGGAGG - Intronic
996045635 5:118869959-118869981 CCGCTTCACACAAGAGCTGGTGG + Intronic
998205642 5:140155281-140155303 CAGCTCCCCTGACGTGCTGGTGG + Intergenic
998400203 5:141844798-141844820 CCTCTGCCCACAAGGTCTGGAGG - Intergenic
999420966 5:151442797-151442819 CCAGGGCCCAGGAGTGCTGGAGG - Intronic
1000579520 5:163018222-163018244 CCCTTGCCCAGAAGTTGTGGGGG - Intergenic
1001095794 5:168774551-168774573 CAGGTGCCCAGAAGTGTTTGGGG - Intronic
1001118822 5:168962106-168962128 AAGCTGCCCAGAGATGCTGGTGG - Intronic
1002830988 6:820790-820812 CTGCTGCCCAGAAACTCTGGAGG - Intergenic
1003661444 6:8065756-8065778 CAGCTGGTCAGAAGTGCAGGTGG + Intronic
1006473930 6:34243392-34243414 CCGATGCCCAATAGTGATGGGGG - Intronic
1007110936 6:39313307-39313329 CGGCTGCCCAGAAAGGCTGAAGG - Intronic
1007832044 6:44646239-44646261 CCTCTGCCCAGCAGTCCTGTTGG - Intergenic
1008487947 6:52055605-52055627 CGGCTGCCCAGAAGGGCTATCGG - Exonic
1011665711 6:89630733-89630755 CGGCTGCCCACAGGTGCTGCTGG - Exonic
1015708189 6:136110894-136110916 CAGGTGCTCAGAAGTCCTGGAGG - Intronic
1016934716 6:149441148-149441170 CAGCTGCCCACAGGTGCTGCAGG + Intergenic
1017282226 6:152637135-152637157 CCGGTGCCTGGAAGAGCTGGGGG + Intronic
1018373317 6:163187768-163187790 CCGCGTCACAGCAGTGCTGGAGG - Intronic
1019155867 6:170038507-170038529 CTGCTTCCCAGCTGTGCTGGGGG + Intergenic
1019443142 7:1057423-1057445 CCCTGGCCCAGAAGTGCTGCAGG - Intronic
1019482838 7:1274326-1274348 CCGCAGGCCTGAAGTGGTGGGGG + Intergenic
1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG + Intronic
1022519386 7:30996205-30996227 CCGCTCCCAAGCAGTGCTGCAGG - Intergenic
1022905455 7:34850908-34850930 CCTCGGCCAGGAAGTGCTGGTGG + Intronic
1023913858 7:44573992-44574014 TCACTTCCCGGAAGTGCTGGCGG + Exonic
1024784118 7:52886588-52886610 CTGCAGCCCAGAAGCCCTGGAGG + Intergenic
1027566323 7:79799533-79799555 CTTCAGCCCAGAAGTGCTGCAGG - Intergenic
1027954717 7:84863591-84863613 CCTCTTCCCATAAGTGCTGGAGG - Intergenic
1033586868 7:142780610-142780632 CCCCTGCTCAGAAGCCCTGGTGG + Intergenic
1035596150 8:859571-859593 CCCCTGCCCAAACCTGCTGGGGG + Intergenic
1035726667 8:1829071-1829093 CCGCCCCCCAGGTGTGCTGGAGG - Intronic
1036952509 8:13154385-13154407 CTGCGGGCCAGCAGTGCTGGGGG + Intronic
1038779462 8:30557702-30557724 GAGCAGCCCAGAAGTGCTGCTGG - Intronic
1039948813 8:42152472-42152494 CCGCGGCCCAGTGGGGCTGGGGG + Intergenic
1039981419 8:42412157-42412179 CCTCTGCCCATGAGTGCTGGAGG + Intergenic
1041862992 8:62535486-62535508 CCGGTGGTCAGAAGTTCTGGAGG - Intronic
1042724544 8:71859364-71859386 CAGCTGCCCAGAACTGCTGCAGG + Intronic
1044036998 8:87318601-87318623 CAGCTTCCCAGAAACGCTGGAGG + Intronic
1045388067 8:101690062-101690084 CTGCTACCCTGATGTGCTGGAGG + Intronic
1047372579 8:124268068-124268090 CCCCTCCTCAGAAGTGCTTGGGG + Intergenic
1055612076 9:78032659-78032681 CCGGTGCCCAGAGGTGTAGGGGG + Intergenic
1056899131 9:90582465-90582487 CCTCTGCCCAGTGGTACTGGGGG + Intergenic
1057274682 9:93670087-93670109 CCACTTCCCAGAAGCACTGGAGG - Intronic
1057307364 9:93920144-93920166 CTGGCACCCAGAAGTGCTGGTGG + Intergenic
1059800414 9:117744892-117744914 CCGATGCCCCGAAGTCCTGTGGG + Intergenic
1060488455 9:124064637-124064659 ATGCTGCCCAGAAATGCTGATGG - Intergenic
1060884540 9:127141114-127141136 CAGCTGCCCAGCGCTGCTGGAGG - Intronic
1062000600 9:134213959-134213981 CCCCTCCCCAGAGGTGCAGGAGG - Intergenic
1062344830 9:136109838-136109860 ACGCTGCCCAGCTGGGCTGGGGG + Intergenic
1062711277 9:137976403-137976425 CCCAACCCCAGAAGTGCTGGTGG - Intronic
1186537338 X:10363783-10363805 ATGCTGCCCTGAAGTCCTGGAGG + Intergenic
1189543828 X:42021147-42021169 CAGCTGGGCAGAAGTGCAGGTGG - Intergenic
1191159416 X:57312058-57312080 CCCCTGCCCAAGAGGGCTGGTGG + Intronic
1191864141 X:65690410-65690432 CCCCAACCCAAAAGTGCTGGAGG + Intronic
1191911914 X:66160620-66160642 CTGCTGGTCAGAAGTGGTGGTGG + Intergenic
1192189347 X:68981232-68981254 CAGGTGCCCAGAGATGCTGGAGG - Intergenic
1192818760 X:74620855-74620877 ACGCTGGCCAGAAGTGGGGGCGG - Intergenic
1197337962 X:125231295-125231317 CCATTGACCAGAAGTTCTGGAGG + Intergenic
1198035180 X:132794894-132794916 CCACTGCCCCGAAGTACTGGGGG + Intronic
1198267482 X:135022605-135022627 GCTCTGCCCAGAAGGCCTGGAGG + Intergenic
1200050293 X:153425804-153425826 CAGCTGTCCAGAACTCCTGGAGG - Intergenic