ID: 1179546040

View in Genome Browser
Species Human (GRCh38)
Location 21:42112813-42112835
Sequence CTCTGGATGTGTAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179546040 Original CRISPR CTCTGGATGTGTAGAGCAGA TGG (reversed) Intronic
901228315 1:7627756-7627778 TTCTTTATGTGTAAAGCAGATGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
906078479 1:43068652-43068674 CCCTGGATGTACGGAGCAGACGG - Intergenic
906582932 1:46951349-46951371 CTCTGGCTGTGTGAAGCACAAGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
916332988 1:163639063-163639085 CTATGGATGTGTGGAGATGAAGG - Intergenic
917245398 1:172995641-172995663 GTGTGGATGTGTTGAGGAGAAGG - Intergenic
918105810 1:181414085-181414107 CTCTGTTTGTGTAGGGCAAAAGG + Intronic
921546239 1:216478245-216478267 CTATGGATGTGTTGGGCAGGGGG + Intergenic
923427017 1:233881012-233881034 CTCTGGTTTTGCAGAGCTGAGGG + Intergenic
1064730798 10:18328843-18328865 CACTGGATATGTAGAGAATAAGG + Intronic
1067825899 10:49572677-49572699 ATCTGGCTGTGCACAGCAGAGGG - Intergenic
1070440330 10:76436648-76436670 GTCTGGGTGTGAAGAGCACAGGG - Intronic
1071572113 10:86703035-86703057 CTCTGGCTGCGGAGAGCAGCAGG + Intronic
1072076188 10:91976413-91976435 CTCTGGAGGTGGGGAGCAGGAGG + Intronic
1074487814 10:113905187-113905209 CTCTTGATGAGTAAAGCAAATGG - Intronic
1075036051 10:119068228-119068250 CTCTGAACGTGTGGAGCACAGGG + Intronic
1076037587 10:127213752-127213774 CTTTGGCTGTGTAGCGCACAAGG + Intronic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1079000054 11:16745180-16745202 CTCTGAATGTGTAGAACACCAGG + Intronic
1079531354 11:21458061-21458083 ATCTGGCTGTGAAGAGAAGAAGG + Intronic
1080805722 11:35651511-35651533 CTCAGGCTGTGCAGGGCAGAGGG - Intergenic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1082232657 11:49787452-49787474 CTATTGATGTGCAGTGCAGATGG - Intergenic
1084680793 11:70665081-70665103 CCCTGGATGTCGAGATCAGAGGG - Intronic
1086829190 11:91538556-91538578 CTCTGGACATGTAGAACAGCTGG + Intergenic
1090413964 11:126528152-126528174 GTCTGGGTCTGTAGAGCAGGAGG - Intronic
1092598851 12:10036569-10036591 CTGTGGATGTGTAGAAGAGAAGG - Intronic
1092906135 12:13101684-13101706 CTCGGGATGTGTCGAGCTGCTGG + Intronic
1093347345 12:18054919-18054941 CACTGGATGTGGAGAGGAAATGG - Intergenic
1096438889 12:51621618-51621640 CTCTGGATGTGGAGAGACTAGGG + Intronic
1097313955 12:58152287-58152309 CACTGGATCTGTAGATCATATGG + Intergenic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1099281850 12:80659930-80659952 CTCAGGATGTCAAGAACAGATGG + Intronic
1099705025 12:86141149-86141171 CTCTGAATTTGTTGATCAGATGG - Intronic
1100524236 12:95405061-95405083 CTGTGGCTCTCTAGAGCAGAGGG - Intergenic
1101047138 12:100820161-100820183 TTCTAGATGTTTAGAGCAGAAGG + Intronic
1103587706 12:121968428-121968450 GTGTGGATATGTGGAGCAGAGGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105012363 12:132764300-132764322 CGCTGGATGTGTTCAGGAGACGG - Intergenic
1105657778 13:22459120-22459142 TTGTGGATGTGTAAAGCAGTAGG - Intergenic
1106381827 13:29246633-29246655 TTCTGAATGTGTATAGCTGAGGG + Intronic
1107350962 13:39514332-39514354 CTCTGGATGTGGAGAGGGGTTGG - Intronic
1109286030 13:60409258-60409280 CTCTGTTAGTGTAGTGCAGAAGG + Intronic
1110050857 13:70897261-70897283 CTCTGAATGTTTTGGGCAGAAGG - Intergenic
1112300890 13:98229046-98229068 ATCTGCATGTCTAGAGCAGCAGG - Intronic
1114733346 14:25018048-25018070 TTCTGGATGTGCTGAGCAGGGGG - Intronic
1117994677 14:61467475-61467497 CGCTGGATGTGGGGAGGAGAAGG + Intronic
1118705636 14:68477876-68477898 CTCTAGATGTGTAGGGCTGAGGG + Intronic
1119729669 14:76943020-76943042 CTCTGGAAGTACAGAGCAGTTGG - Intergenic
1121095613 14:91216162-91216184 CTCTTGAGGTGGAGAGCAGGAGG + Intronic
1122342792 14:101039210-101039232 CTCTGGATGTGAAGAGGCCAGGG + Intergenic
1124247393 15:28082609-28082631 CTATGGATGTGTAAAGAATAAGG + Intronic
1125350372 15:38760441-38760463 CTATGAAAGTGTAGAGAAGATGG + Intergenic
1126524636 15:49638088-49638110 CTGTGGATGTTTACAGCAGCAGG + Intronic
1126866098 15:52938422-52938444 CACTGCATTTGTAGATCAGATGG + Intergenic
1127024313 15:54785947-54785969 TTCTGCATCTGTTGAGCAGATGG - Intergenic
1127836514 15:62795077-62795099 CTCTGGAAGAGGAGAGCAGGGGG + Intronic
1128408785 15:67371572-67371594 CTCTGGATATTAAGAGAAGATGG + Intronic
1128885671 15:71285085-71285107 CTCTGAAGATGTAGAGCGGATGG - Intronic
1128953567 15:71914338-71914360 TTCTGGTTGTTTATAGCAGAAGG + Intronic
1129945946 15:79539410-79539432 CCCAGGATGAGAAGAGCAGATGG + Intergenic
1132361592 15:101220611-101220633 CTCTCCATGAGCAGAGCAGAGGG + Intronic
1135833741 16:25803956-25803978 CTCTGGAGGTGAGGAGGAGAGGG - Intronic
1136042688 16:27593003-27593025 ATCTGGATGTGAAGAACAGATGG + Intronic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1137524927 16:49226623-49226645 CTCAGGGGGTGTTGAGCAGAAGG - Intergenic
1141464713 16:84197844-84197866 CTCTGGATGGGGAGAGAAGATGG + Intergenic
1141834805 16:86531719-86531741 CTCTGGAGGGACAGAGCAGAGGG - Exonic
1143637461 17:8174345-8174367 CTCTGAAAGTGTAGGGCAGGTGG + Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1145178311 17:20721415-20721437 GTCTGGATGTGAAAAGCACAAGG - Intergenic
1147479853 17:40749994-40750016 GTCTGGATGTCTAGAGCTCAGGG - Intronic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149019126 17:51943233-51943255 CTCTGGATTTCTAGAGAAGCTGG + Intronic
1149447301 17:56723475-56723497 CCCTACATGTGTAGAACAGATGG - Intergenic
1150303581 17:64065766-64065788 CTCTGGATGCTGAGAGCAAAAGG + Intronic
1150941251 17:69696943-69696965 CTCTGGATATTGAGAGCAGCAGG + Intergenic
1151336921 17:73445514-73445536 CTCTGGTTCTGAAGAGCATAGGG + Intronic
1152036367 17:77875525-77875547 CTCTGGATGGGTTGAGCAAGAGG + Intergenic
1153307507 18:3645628-3645650 CTCTGCCTGGGTAGATCAGAAGG - Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1155772550 18:29720331-29720353 CTCTGGTTTTGTAGATGAGAGGG - Intergenic
1156481253 18:37437729-37437751 CTCTGGCTGTGGAGATCAGGAGG - Intronic
1157566317 18:48681212-48681234 CCCTGGCTGTATAGAACAGAGGG - Intronic
1159636716 18:70813429-70813451 CTCTGGAGGTCTAAAGGAGATGG - Intergenic
1159918842 18:74209414-74209436 AACAGGATATGTAGAGCAGAAGG - Intergenic
1161258208 19:3321399-3321421 CTCTGGATCAGCTGAGCAGAGGG + Intergenic
1163869151 19:19803650-19803672 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163903511 19:20129610-20129632 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163910598 19:20187872-20187894 CTCTGAATTTGTAGTGGAGAGGG + Intronic
1163911999 19:20203876-20203898 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163917311 19:20252462-20252484 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163925095 19:20333427-20333449 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163931087 19:20392841-20392863 CTCTGAATTTGTAGTGAAGAGGG + Intergenic
1163932310 19:20407750-20407772 CTCTGAATTTGTAGTGAAGAGGG - Intergenic
1163941404 19:20498372-20498394 CTCTGAATTTGTAGTGAAGAAGG + Intergenic
1163956296 19:20644471-20644493 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163959915 19:20679945-20679967 CTCTGAATTTGTAGTGAAGAGGG + Intronic
1163974518 19:20837247-20837269 CTCTGAATTTGTAGTGAAGAGGG - Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164753976 19:30676339-30676361 CTGTGAATGTGTAAAGAAGATGG + Intronic
925696812 2:6589296-6589318 CTCTGGATGATTTAAGCAGAGGG + Intergenic
926234562 2:11029530-11029552 CTCTGGTTCTGCAGAACAGAAGG - Intergenic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
927562427 2:24083516-24083538 CTCAGAAGCTGTAGAGCAGAGGG + Intronic
927975927 2:27338192-27338214 CGATGGAGGAGTAGAGCAGAAGG - Intronic
928017625 2:27673043-27673065 CTCTGGATTTCTACTGCAGATGG + Intronic
928672772 2:33619411-33619433 GTCTGGATCTGGAGAGCTGATGG + Intergenic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
929919501 2:46162214-46162236 GCCTGGATGTCTAGAGCAAAAGG + Intronic
933127764 2:78632403-78632425 CTCAGGATTTGTACACCAGACGG + Intergenic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
934736739 2:96693485-96693507 CCCTGGAGGGGTAGAGGAGAAGG - Intergenic
934813412 2:97304037-97304059 GTCTGGAGGAGAAGAGCAGAGGG + Intergenic
934824283 2:97404443-97404465 GTCTGGAGGAGAAGAGCAGAGGG - Intergenic
935482719 2:103613288-103613310 CCCTGGATGATTAGAGCAGGTGG + Intergenic
935763669 2:106343735-106343757 CTCAGGATGTGGAGAGCAGGAGG - Intergenic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
938777019 2:134550896-134550918 CTCTGGAGATATAGAGCGGAAGG + Intronic
941678663 2:168371506-168371528 CTCTGCCTGTGAAAAGCAGAAGG + Intergenic
942319882 2:174727155-174727177 CTCTGGATGTTTACAGTAAAGGG + Intergenic
944580124 2:201125219-201125241 GTGTGGCTGTGTAGAGGAGATGG + Intronic
944616407 2:201465140-201465162 TTCTGGTTGAGTAGAGGAGAGGG - Intronic
945689809 2:213019700-213019722 CACTGGGTAGGTAGAGCAGAGGG - Intronic
948544521 2:238717343-238717365 CTCTGGATGGGAAGGACAGACGG + Intergenic
1170905798 20:20514474-20514496 ATCTGGATGTGGAGTGGAGAGGG - Intronic
1172355762 20:34278548-34278570 CTCTGGAACTGTAAACCAGAGGG - Intergenic
1173317062 20:41954587-41954609 ATCTGGATGAGGGGAGCAGATGG + Intergenic
1173501496 20:43557587-43557609 CTCTGGAAGAGCAGAGGAGAGGG + Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176385786 21:6138038-6138060 CTGTGGATGCGTAGGCCAGAGGG - Intergenic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1177904489 21:26959003-26959025 CACAGGATCTGTTGAGCAGAGGG + Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179737687 21:43400214-43400236 CTGTGGATGCGTAGGCCAGAGGG + Intergenic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
953544507 3:43854421-43854443 AACTGAATATGTAGAGCAGAGGG - Intergenic
955984615 3:64559652-64559674 CTTTGCATGTGTCGTGCAGATGG - Intronic
956532499 3:70236207-70236229 ATCTGGATCTGTAGATCACAAGG - Intergenic
957556583 3:81769642-81769664 CACAGGATGAGTACAGCAGAAGG + Intergenic
962992894 3:140595644-140595666 CTCTAGATGTGTCGGGGAGAGGG - Intergenic
963332101 3:143926090-143926112 ATCTCAATGTGAAGAGCAGATGG - Intergenic
966772836 3:183519153-183519175 CTCTGGATTTGTAAAGGAGAGGG + Intronic
967415147 3:189208676-189208698 TTCTGCATATGTAGAGCATATGG + Intronic
968334539 3:197901637-197901659 CTCCGCATGTGGAAAGCAGATGG + Intronic
970324010 4:14904251-14904273 CACTGGAAGTGTAAACCAGAGGG - Intergenic
972104148 4:35461671-35461693 CTCTGGTTTTTTAAAGCAGAAGG + Intergenic
972337711 4:38122396-38122418 CACTGGTTGTGCAGGGCAGAAGG - Intronic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
974082851 4:57230774-57230796 CTCTTTATCTGTAAAGCAGAAGG + Intergenic
979013500 4:115400983-115401005 CTCTGTAAGTGTAGAGCATCCGG - Intergenic
981285122 4:143007911-143007933 CTCAGGATGTTAAGAACAGAGGG + Intergenic
983368500 4:166827362-166827384 ATATGGATGTGTACAGCAGCTGG + Intronic
983998908 4:174217428-174217450 CTCTGGAGCTGTAGAGCACCAGG - Intergenic
984129855 4:175860885-175860907 CTCTTTATGTGTAAAGCATATGG + Intronic
984814373 4:183822985-183823007 CTCAGGAGGTGCACAGCAGATGG - Intergenic
985836298 5:2274632-2274654 ATATGGATTTGTAGAGCAGATGG - Intergenic
987384763 5:17318692-17318714 CTCTTGATCTTCAGAGCAGAAGG + Intergenic
988611151 5:32726435-32726457 CTCTGCTTGTGTAAAACAGAGGG - Intronic
990995267 5:61726753-61726775 CTCTGGAAGTGGGGAGCAAAGGG + Intronic
992194265 5:74324386-74324408 CTCTGGATGTTTCAAACAGAAGG - Intergenic
998106255 5:139471211-139471233 CTCTAGATGTGCAGAGGAAAAGG - Intergenic
1002430923 5:179203342-179203364 GTCTGGAGCTGTAGAGCAGGTGG - Intronic
1004443112 6:15672315-15672337 CTCTGAATGTAAAGAGGAGAGGG + Intergenic
1004755787 6:18608767-18608789 CTGAGGCTGTGTAGAGCAGTGGG + Intergenic
1005467972 6:26133784-26133806 CTTTGGATTTGTAGAGATGAAGG - Intronic
1006029868 6:31170737-31170759 CCCTGGATGGGTGGAGGAGAGGG + Intronic
1006994356 6:38244490-38244512 CTCTGGATTTTTAGAGTAAAAGG - Intronic
1008652201 6:53574961-53574983 AACTGGATCTTTAGAGCAGAAGG + Intronic
1009512228 6:64567840-64567862 TTCTAGTTGTTTAGAGCAGAAGG - Intronic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1013824811 6:114198564-114198586 CTGCCGATGTGTAGAACAGAAGG - Intronic
1014009091 6:116456651-116456673 CAATGGAAGTGTAAAGCAGAAGG - Intergenic
1014101610 6:117517548-117517570 CTCTGCTTGGGTAGTGCAGAAGG - Intronic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023052667 7:36266799-36266821 CTCTGGATGTCTTGTGCAAATGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1028032439 7:85933036-85933058 CTCTGCTAGTGCAGAGCAGAAGG + Intergenic
1030282736 7:107793675-107793697 CTCTGAATGTGTACAGCTCAGGG - Intronic
1031715137 7:125099611-125099633 CTCTGCATGTTTGGAGCAGTGGG + Intergenic
1033271971 7:139940153-139940175 CTTTGCATATGAAGAGCAGAGGG + Intronic
1037556031 8:20023458-20023480 TGCTGGGTGTGTGGAGCAGATGG + Intergenic
1037802707 8:22044071-22044093 CCCTGGATGTGTGAAGCAAAAGG - Intronic
1038585234 8:28782500-28782522 CTCTGAATGTGTACAGCATGTGG + Intronic
1039797891 8:40931051-40931073 CTCTGTGTGTCTAGAGTAGAGGG - Intergenic
1042474485 8:69231713-69231735 CTCCGCATGTGTGGAGCAGGAGG + Intergenic
1044253814 8:90036419-90036441 TTCTTGATGTTTACAGCAGAAGG + Intronic
1045358438 8:101410558-101410580 CTCTGGAGGGATAGAGCTGAAGG + Intergenic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1047250730 8:123180453-123180475 CTCTGAACGTGTAGAGCACGGGG - Intronic
1047332516 8:123904632-123904654 CACTGGAAGTGTTGAGCAGAGGG + Intronic
1047757607 8:127930727-127930749 GTCTGTCTGTGTAGAGCAGTGGG + Intergenic
1049979647 9:892429-892451 GCCTGGGTGTGTAGAGCAGAGGG - Intronic
1050651609 9:7782941-7782963 ATCTGGATGTGTGGAGGAGCTGG - Intergenic
1051574644 9:18600947-18600969 CTCTGGATTTGAAAAGCAGTAGG - Intronic
1051784051 9:20722306-20722328 TTGTGGATGTCTAGAGAAGAGGG - Intronic
1052512310 9:29437620-29437642 CTCTGTGTGTGTATTGCAGAGGG - Intergenic
1057842462 9:98497025-98497047 CTATGGATGTGAAAAGCAAAGGG + Intronic
1057904907 9:98975798-98975820 CTGTGGATGTTTAGAGGAGGGGG + Intronic
1059341478 9:113599884-113599906 CTTTGGCTGTGCAGAGCAGCTGG + Intergenic
1059660582 9:116396406-116396428 CACTGGATTTGAGGAGCAGAAGG - Intronic
1061022835 9:128027306-128027328 CTCTGGGTGTTTAGAACTGAGGG + Intergenic
1061135382 9:128730530-128730552 TTCTGGATGTGTTTGGCAGAAGG + Exonic
1062352866 9:136147793-136147815 CTCTGGCTTCGTAGAGCCGAAGG + Intergenic
1186150889 X:6673359-6673381 CTATGCATGTGTAGGGGAGAAGG - Intergenic
1187612869 X:20961382-20961404 CTCTGCATGAGAAAAGCAGAGGG + Intergenic
1189893545 X:45630355-45630377 CTCTGGTGGGGTAGAGCAGGGGG + Intergenic
1192732899 X:73819017-73819039 GGCTGGATGTGTAGGACAGAGGG - Intergenic
1196882647 X:120212620-120212642 CACTGCATTTGTAGATCAGATGG + Intergenic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199546722 X:149013942-149013964 CTCAGGATTTGTAGAGGGGAGGG - Intergenic
1199685262 X:150259796-150259818 CTCTGCATGAGGATAGCAGAAGG - Intergenic
1200075374 X:153548072-153548094 CCCAGGCTGTGTAGAGCAGGTGG + Intronic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic