ID: 1179547119

View in Genome Browser
Species Human (GRCh38)
Location 21:42120215-42120237
Sequence GTGTTTGCACAGATTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179547119 Original CRISPR GTGTTTGCACAGATTGCTGG TGG Intronic
901194586 1:7433289-7433311 GAGGTTGCTCAGGTTGCTGGAGG - Intronic
902672831 1:17986783-17986805 GTGTTTGCTCACAATTCTGGAGG + Intergenic
905633363 1:39531458-39531480 GTGTTTTCAGAGGTTGCTGCTGG - Intergenic
906440242 1:45836877-45836899 GTTTTTCCACAGATGGGTGGAGG + Intronic
907775952 1:57515215-57515237 GTGTCTGCACATATTGCTACAGG - Intronic
908030255 1:59991632-59991654 GTGATTGCACAGCAAGCTGGAGG - Intronic
915068503 1:153245895-153245917 GTGTTTGGACAGGCTGCTGTAGG - Intergenic
918104354 1:181403776-181403798 GTATTGGCTCATATTGCTGGTGG + Intergenic
919574822 1:199294645-199294667 GTTATTGGACAGATTGATGGGGG - Intergenic
919958804 1:202445182-202445204 GTGTTTGCACTGATTGGTGCAGG - Intronic
922064113 1:222119816-222119838 GAGTTTTCATACATTGCTGGTGG + Intergenic
924375581 1:243404630-243404652 GTCTTTGCACACAATTCTGGAGG - Intronic
1062776910 10:158334-158356 GTGTTTTCATACATTGCTGGTGG - Intronic
1064299255 10:14108059-14108081 GCACTTGCAGAGATTGCTGGTGG - Intronic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1067023077 10:42818996-42819018 GTGCTTGCCAAGATTGCTGAAGG - Intronic
1067104319 10:43355804-43355826 GTGTTGGCCCAGATTACTTGAGG - Intergenic
1067268181 10:44765895-44765917 GTGTTTGCTCAGAATGCTGTTGG - Intergenic
1067820772 10:49527833-49527855 GTGTGTGTACAAATTGTTGGTGG - Intronic
1067849485 10:49745649-49745671 GCCTTTGCACAGATTGCTCTTGG + Intronic
1070615264 10:77964825-77964847 ATTTTTCCACAGACTGCTGGAGG - Intergenic
1070784652 10:79155925-79155947 GCATGTGCACAGAGTGCTGGCGG - Intronic
1072812985 10:98478000-98478022 GTTTTTCCACAGACTGTTGGGGG - Intronic
1075219638 10:120573769-120573791 GTGTGTGCACAGATCGCTGGTGG + Intronic
1075630691 10:123999026-123999048 GTTTTTCCACAGTTTGGTGGGGG + Intergenic
1075811771 10:125229367-125229389 GTTATTGTACAGTTTGCTGGGGG - Intergenic
1076140365 10:128073550-128073572 GTGTTTGCAGTGATGGCAGGTGG - Intronic
1076308175 10:129479818-129479840 GTGTTTGCCCTCCTTGCTGGGGG + Intronic
1080858331 11:36131200-36131222 GTTTAAGCACAGATTACTGGTGG - Intronic
1081746090 11:45473469-45473491 GTGTTTTCATAGCCTGCTGGTGG + Intergenic
1083442994 11:62689340-62689362 GGATTTGCACAGATAGCAGGTGG - Intronic
1085250880 11:75143021-75143043 GTGTGTGCACAGAATGTGGGGGG + Intronic
1087179735 11:95129789-95129811 GAGTTTGCACATATAACTGGAGG - Exonic
1087628013 11:100619160-100619182 GTGTTAACACATATTGCTTGTGG + Intergenic
1089123849 11:116162316-116162338 GTGTTTGCCCACATGGCTGTAGG - Intergenic
1089861312 11:121592230-121592252 CTGTTTGCACTGATGGATGGTGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091566521 12:1652650-1652672 GTATTTGCCCAGGCTGCTGGAGG - Intergenic
1095458531 12:42416407-42416429 GTGTATGCACTGATTCCAGGTGG - Intronic
1095510512 12:42946698-42946720 CTGTTTGCAAAGATAGCTGTAGG - Intergenic
1095643502 12:44513063-44513085 GTGGTTGCACATATTTATGGGGG - Intronic
1097819825 12:64117128-64117150 GTGTTTGGAAAGTTTGCTTGTGG + Intronic
1099425172 12:82514915-82514937 GTATTTGCACATATTGAAGGAGG + Intergenic
1101440739 12:104702711-104702733 GTGCTTGAAGAGACTGCTGGGGG - Intronic
1103236054 12:119373615-119373637 AAGTTTGCACAGATTTTTGGTGG - Intronic
1104493854 12:129218447-129218469 GTGATTGCACAGAATGCTACAGG + Intronic
1107674482 13:42780371-42780393 GTGATTGCACATAGAGCTGGAGG - Intergenic
1108348315 13:49567461-49567483 GGGATTGCACACATGGCTGGGGG - Intronic
1109453479 13:62550378-62550400 GTGTTTGCTCAGAATTCTCGGGG - Intergenic
1110820769 13:79913391-79913413 GTCTTTGCACTGATTGCTTTGGG - Intergenic
1112517642 13:100068731-100068753 GTATTTCCACACATTGCTGTTGG + Intergenic
1113642915 13:111971018-111971040 GTGTCTGCTCACATTCCTGGGGG - Intergenic
1115327107 14:32152202-32152224 GTTTTTCCACAGATGGGTGGGGG - Intronic
1119652832 14:76395699-76395721 GTGTTTACAGAGAATGCTTGGGG - Intronic
1122000449 14:98646807-98646829 GTGTCTACACAGCTTGCTGATGG - Intergenic
1122787504 14:104170777-104170799 GTGTTTGCAGTGATTGCTCTGGG + Intronic
1123424226 15:20156176-20156198 GTGCTTGCCAAGATTGCTGAAGG - Intergenic
1123533447 15:21162705-21162727 GTGCTTGCCAAGATTGCTGAAGG - Intergenic
1126345790 15:47692683-47692705 CTGTTTGCAGACATGGCTGGTGG + Intronic
1127107341 15:55630530-55630552 GATCTTACACAGATTGCTGGTGG - Intronic
1128863232 15:71092308-71092330 GTGGTTGCACAGTTTCCTAGAGG + Intergenic
1128935150 15:71739740-71739762 CAGTTTGCAGAGATTCCTGGGGG - Intronic
1130537751 15:84799144-84799166 GTGTTTGCGCAGGCTGTTGGGGG - Exonic
1130637469 15:85638478-85638500 GTGTTAGCTCAGATTGGTTGAGG + Intronic
1131433718 15:92406533-92406555 GTGTATGCACACTTTGCTGGGGG + Intronic
1132537366 16:489255-489277 GTGTTTGCACACTTGGCTTGCGG + Intronic
1132815443 16:1824016-1824038 GTGGCAGCACAGCTTGCTGGAGG - Intronic
1132943545 16:2520226-2520248 GTGTCTGCTCAGCTTGTTGGGGG + Intronic
1136860637 16:33699711-33699733 GTGTTTGCCAAGATCGCTGAAGG + Intergenic
1138425950 16:56932160-56932182 GTCGTTGCAGAGATTGCGGGCGG + Exonic
1138943694 16:61821628-61821650 GTGTCTGAACAGCTTGCTGCAGG - Intronic
1139182847 16:64768154-64768176 GTGTTTGCAAAGATTCTGGGAGG + Intergenic
1139631071 16:68232245-68232267 GAGTTTGTAAAGATTGCAGGGGG - Exonic
1141955438 16:87367873-87367895 ATCTTTGCTCAGATTGCTGAAGG + Intronic
1203122138 16_KI270728v1_random:1547894-1547916 GTGTTTGCCAAGATCGCTGAAGG + Intergenic
1149455116 17:56781538-56781560 GTGTTTTCACGGAGTGCTAGGGG - Intergenic
1152137130 17:78511088-78511110 GTGTTTTCTCACAGTGCTGGAGG - Intronic
1152371784 17:79892868-79892890 CTGTTTGGACAAAGTGCTGGGGG - Intergenic
1153258760 18:3199952-3199974 GTGTTTGCATAGATTAATGGTGG - Intronic
1155510936 18:26576069-26576091 GTGTTAGCAAAGCTTCCTGGAGG - Intronic
1157364993 18:47056452-47056474 GAGCTTGAACAGATGGCTGGTGG + Intronic
1159760288 18:72417276-72417298 GTGTTTACACGGATTGAAGGTGG - Intergenic
1162916638 19:13877766-13877788 GTGCCTGCACAGGTGGCTGGGGG + Intronic
1164553576 19:29232710-29232732 GTGGTTGAATAGAGTGCTGGAGG - Intergenic
1166857044 19:45787434-45787456 GTTTTTCCACAGACTGTTGGGGG - Intronic
924962135 2:45417-45439 GTGTGTGCCCAGAAGGCTGGGGG - Intronic
925136596 2:1527649-1527671 GAGGTTGCACAGATTGGGGGGGG - Intronic
927480005 2:23445712-23445734 GTGTTCTCACACATTGCTGAGGG - Intronic
927770802 2:25859423-25859445 GTGATTTCATACATTGCTGGTGG + Intronic
928748572 2:34444509-34444531 GTGCTTTCATAGATTACTGGTGG + Intergenic
929531930 2:42758129-42758151 CTGGGTGCAGAGATTGCTGGAGG + Intergenic
930615233 2:53586917-53586939 ATGTTATCACAGTTTGCTGGAGG - Intronic
932005316 2:67921696-67921718 GTGGTTGCACAGATTGCAGCTGG - Intergenic
934459018 2:94200863-94200885 GTGTTTGCCAAGATCGCTGAAGG + Intergenic
934883895 2:98007789-98007811 GTCTTTGCACTGACTGCTGGAGG + Intergenic
938341884 2:130541311-130541333 TTGATTGCACAGATGGCAGGAGG - Intronic
938347946 2:130579400-130579422 TTGATTGCACAGATGGCAGGAGG + Intronic
941181970 2:162270465-162270487 GGCTTTGAACAGATTACTGGTGG + Intronic
946015606 2:216601790-216601812 TTGTTGAAACAGATTGCTGGTGG - Intergenic
946023216 2:216656138-216656160 GTGTTTCCAGAGATTGCAGAGGG + Intronic
949042296 2:241854980-241855002 TTATTTGCACACATTGGTGGAGG + Intronic
1168805795 20:671707-671729 GAGTTTCCTCAGCTTGCTGGGGG + Intronic
1169807910 20:9578238-9578260 GAGTGTGCAGGGATTGCTGGTGG + Intronic
1170673984 20:18461965-18461987 GTGTTTTCATGCATTGCTGGTGG - Intronic
1170822642 20:19767378-19767400 GTTTTTACACAGAATGGTGGAGG + Intergenic
1171072640 20:22090320-22090342 TTGTTTGCAATGATTCCTGGGGG + Intergenic
1171724154 20:28600831-28600853 GTATCTTCACACATTGCTGGTGG + Intergenic
1171859209 20:30379193-30379215 GTATCTTCACACATTGCTGGTGG - Intronic
1173968711 20:47133752-47133774 GTGTTCGCACACATTGTTGCTGG - Intronic
1176211483 20:63925120-63925142 GTGCTTGCAGAGCTTGCTGATGG + Intronic
1179547119 21:42120215-42120237 GTGTTTGCACAGATTGCTGGTGG + Intronic
1180060110 21:45380659-45380681 GTGTGTGCACAGATGGATGCTGG - Intergenic
1180060130 21:45380793-45380815 GTGTGTGCACAGATGGATGCTGG - Intergenic
1180297706 22:10959506-10959528 GTATCTTCACACATTGCTGGTGG + Intergenic
1180610578 22:17094595-17094617 GTGTTAACACAGTTTGCTGGGGG - Intronic
1182745458 22:32602296-32602318 GTGTTTGCAAAGATTGCACGTGG - Intronic
950791321 3:15474628-15474650 CAGTTTGCACAGAGTGCTGGAGG - Intronic
952144918 3:30521852-30521874 GCTCTTGCTCAGATTGCTGGAGG - Intergenic
954047330 3:47943712-47943734 GTGTTTTCAAATATTGCTAGAGG - Intronic
954673820 3:52304773-52304795 GTGGGCGCACAGATGGCTGGTGG + Intergenic
955773642 3:62411214-62411236 GTTTTTGAACTGAATGCTGGAGG + Intronic
957326794 3:78706161-78706183 GTGTCTGAAAAGCTTGCTGGAGG + Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
958411498 3:93822255-93822277 ATTTTTCCACAGATTGCTTGGGG + Intergenic
958849567 3:99307668-99307690 GTTTTTCCACAGACTGCAGGTGG - Intergenic
959109140 3:102100955-102100977 GTGGTTGCAGAGCTTACTGGTGG + Intronic
960162366 3:114364469-114364491 TTGTTTGCATAAATTGTTGGGGG - Intronic
960229182 3:115204663-115204685 GTGTTGGGACACATTCCTGGAGG + Intergenic
961207781 3:125100315-125100337 GTGTATGTACACATTGCTAGAGG - Intronic
964073867 3:152669278-152669300 GTGTTTGTACACATTGTTGGTGG - Intergenic
964794655 3:160483777-160483799 GTGTTTGGCCAGAATTCTGGGGG - Intronic
965643599 3:170857123-170857145 CAGATTTCACAGATTGCTGGTGG + Intronic
967980760 3:195063820-195063842 GTGTTTCCCCAGACAGCTGGGGG + Intergenic
968484131 4:850592-850614 GTGTTTGCAGAGACTGTTGAGGG - Intronic
968795229 4:2699217-2699239 GGGTTTGCTCAGAGTTCTGGCGG + Intronic
969513468 4:7632847-7632869 GTGTATGCACAAGATGCTGGAGG + Intronic
969627452 4:8314778-8314800 CTGTTTGAACATATGGCTGGAGG + Intergenic
970686145 4:18569914-18569936 GTGTGTGCACTGCTTGCTGATGG + Intergenic
972158156 4:36190725-36190747 ATGTTTGCACAGAATGTTGATGG + Intronic
975854250 4:78606317-78606339 GTGTTTGCTCTGAGTGCTGAGGG + Intronic
976583348 4:86766478-86766500 GTGTTTCCACAGCTTGCTTATGG - Exonic
976823837 4:89237130-89237152 GTGCTTGCAGAGATTTCTGGTGG - Exonic
977104443 4:92863389-92863411 GTATTTTCACAGGCTGCTGGAGG - Intronic
981648661 4:147029682-147029704 GTGATTGCACAGATGGTGGGAGG - Intergenic
981998550 4:151001388-151001410 GTGTCTGCACATATTGTTGGGGG + Intronic
982938386 4:161515958-161515980 ATAATTTCACAGATTGCTGGTGG - Intronic
983143883 4:164188535-164188557 GCGTTTGCTCTGATTGTTGGCGG - Intronic
983523847 4:168739673-168739695 GTGTTTGTACATATTAATGGGGG - Intronic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
986019043 5:3783963-3783985 GTGTTTGCACAGATTCGCGGGGG - Intergenic
987647272 5:20690188-20690210 TTGTTTCCACAGATAGTTGGGGG - Intergenic
989092815 5:37751841-37751863 GTCTTTGTGCAGATTGCTTGAGG + Intronic
989183066 5:38597463-38597485 GTAATTGCACATATTGCTTGTGG + Intronic
992509540 5:77419383-77419405 GTGTTTGCACAGAGTGCAGTGGG + Intronic
993073465 5:83195937-83195959 GTGTGTACACAGTTTGCTTGTGG + Intronic
993272105 5:85809706-85809728 ATGTTTGCATAGATTGCAGCAGG + Intergenic
993956509 5:94241055-94241077 CTCTTTGCACAGATGGCTGGTGG + Intronic
994771716 5:103989855-103989877 GGCTTTGGACAGATTGCAGGTGG + Intergenic
999009468 5:148019747-148019769 ATGTCTGCAGACATTGCTGGGGG + Intergenic
999670791 5:153957519-153957541 GTGTTTGCACAGCAGTCTGGAGG + Intergenic
1004080056 6:12383364-12383386 CTGTTTGCACAGGCAGCTGGAGG + Intergenic
1007220757 6:40276959-40276981 GTGTTTGCACATATGACTTGTGG - Intergenic
1007633654 6:43285768-43285790 GTGTAGGCAGAGATTGCTGGGGG - Exonic
1008128959 6:47698844-47698866 GTTTTTGCACATATTCCAGGAGG + Intronic
1008324133 6:50156051-50156073 GTGTTAGCCTAGATTGTTGGTGG - Intergenic
1009781996 6:68283653-68283675 GAGTTTGCATAGATTTTTGGTGG - Intergenic
1012356123 6:98316562-98316584 GTGTTAGCACAAAGTGCTGTGGG + Intergenic
1012899146 6:104987348-104987370 GTTTTTGCACTTATTTCTGGTGG + Intronic
1018663088 6:166106339-166106361 CTGTTTGCCTCGATTGCTGGTGG + Intergenic
1019011220 6:168844919-168844941 GTGCCTACACACATTGCTGGTGG + Intergenic
1020382832 7:7565746-7565768 GTTTTTGCGCAGAGAGCTGGAGG - Intergenic
1020400869 7:7775682-7775704 GGAATTGCACATATTGCTGGTGG + Intronic
1022557800 7:31317195-31317217 GTGTGTGCACAGATTTAGGGTGG - Intergenic
1023407208 7:39847378-39847400 GTGTGTGCACACATTACTGTAGG - Intergenic
1024090865 7:45938925-45938947 TTGTCTGCACAGAATGCTAGGGG + Intergenic
1024573315 7:50743514-50743536 GTGTCTGCACAGGTTTCTTGAGG - Intronic
1026956614 7:74380368-74380390 GTGTGTGCACAGCGTGCTTGGGG - Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1034005360 7:147466368-147466390 GTTTTTACACAGAATGGTGGAGG + Intronic
1034214824 7:149397430-149397452 GAGTTTGCACTGATATCTGGAGG + Intergenic
1035746279 8:1963826-1963848 GTCTTTGGACACAGTGCTGGAGG + Intergenic
1036583147 8:10096237-10096259 GTGTTGTCACTAATTGCTGGGGG - Intronic
1038414793 8:27387026-27387048 GTGTTTGAGCAGAATTCTGGGGG + Intronic
1042172822 8:66008959-66008981 ATGCTGGCTCAGATTGCTGGAGG - Intergenic
1047701795 8:127456444-127456466 GAGTTAGCAGAGTTTGCTGGTGG - Intergenic
1048288266 8:133159571-133159593 ACGTTTGCATATATTGCTGGTGG + Intergenic
1048442770 8:134472111-134472133 GTGTGTACACAGTTTTCTGGGGG + Intergenic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1052636517 9:31113153-31113175 CTGCTTGCACAGATTGCTGCTGG - Intergenic
1053725447 9:40994241-40994263 GTATCTTCACACATTGCTGGTGG - Intergenic
1054340493 9:63857638-63857660 GTATCTTCACACATTGCTGGTGG + Intergenic
1054941989 9:70753631-70753653 GTTTTTACACAGATTGCTTGAGG + Intronic
1057510026 9:95670228-95670250 GTGTCTGGACAGATTGCTTTAGG - Intergenic
1185745045 X:2565865-2565887 ATGTTGGCACAGTTTGCTGTTGG - Intergenic
1186536255 X:10351914-10351936 GTGCTCCCACACATTGCTGGTGG - Intergenic
1187554137 X:20335110-20335132 AGGTTTGCAAAGATTGATGGAGG + Intergenic
1193189655 X:78554668-78554690 GAGTTGGCACAGTTAGCTGGGGG - Intergenic
1194618692 X:96140167-96140189 GTGTTTGCAGATTTTTCTGGGGG - Intergenic
1195859145 X:109362460-109362482 AAGTTTGCACAGCTTGCTAGTGG - Intergenic
1196378478 X:115063076-115063098 GTGTTTTTACAGAGTGCTGATGG - Intergenic
1196938238 X:120750757-120750779 GTATTTTCAGAGAATGCTGGAGG - Intergenic
1197512993 X:127394719-127394741 GTGTTTTTACAGAGTGCTGATGG - Intergenic
1197895184 X:131305383-131305405 GTGTTTGTACAGACTCCTGAAGG + Intronic
1197978481 X:132191458-132191480 GTATTTGGACAGATTTCTGCAGG + Intergenic
1199776870 X:151019787-151019809 GTGTTCTCACACATTGCTGCTGG + Intergenic
1200047270 X:153409624-153409646 GTGTGTGGACACATTGGTGGTGG - Intergenic
1200089419 X:153627331-153627353 GTGTGTGGACACATTGGTGGTGG + Intergenic