ID: 1179547818

View in Genome Browser
Species Human (GRCh38)
Location 21:42124351-42124373
Sequence CCCGTGCCGGCTCTGGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179547811_1179547818 -4 Left 1179547811 21:42124332-42124354 CCGGCGGCTTCAGAGGGAGCCCG 0: 1
1: 0
2: 1
3: 25
4: 213
Right 1179547818 21:42124351-42124373 CCCGTGCCGGCTCTGGGTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 142
1179547808_1179547818 6 Left 1179547808 21:42124322-42124344 CCTGGAGGGGCCGGCGGCTTCAG 0: 1
1: 0
2: 1
3: 18
4: 192
Right 1179547818 21:42124351-42124373 CCCGTGCCGGCTCTGGGTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179547818 Original CRISPR CCCGTGCCGGCTCTGGGTTG GGG Intronic
900568688 1:3347794-3347816 CCCCTGAGGGCTCTGGGCTGGGG + Intronic
901028446 1:6291841-6291863 CCCCTGCTGGCTCTGGGTTCTGG - Intronic
901919389 1:12525566-12525588 TCCCTGGCGGCTCTGGGATGTGG + Intergenic
902410648 1:16209879-16209901 CCCCTGCCTGATCTGGGTGGTGG - Intronic
902601083 1:17540400-17540422 CCCGTTCCGCCTCTGGGCGGGGG - Intronic
902663829 1:17923758-17923780 CCCCTCCTGGCTCTGGGTAGTGG - Intergenic
902679758 1:18034948-18034970 CCCCTCCCAGCTCTGGGTAGAGG + Intergenic
902876332 1:19342984-19343006 GCCGTGGCGGCTCTGGGGTGTGG + Intronic
903270465 1:22185262-22185284 CCCGAGGGGGCTCAGGGTTGAGG + Intergenic
903740544 1:25556182-25556204 CCTGTCCCACCTCTGGGTTGAGG + Intronic
905342395 1:37288196-37288218 CCTGTGCTGCCTCTGGGATGGGG - Intergenic
917975466 1:180235016-180235038 CCCGGGCGTGCTCTGGGTTTTGG + Intronic
920498698 1:206472961-206472983 CAGGTGCCGGCTGTGGGCTGAGG + Intronic
921521843 1:216166117-216166139 CCCATGCCAAATCTGGGTTGAGG - Intronic
922998678 1:229987552-229987574 GCCCTGCCGGCTCTGGTTTCTGG - Intergenic
1066370642 10:34815544-34815566 CCCGTGCTGGCACTGGGGCGAGG - Intergenic
1066439108 10:35421069-35421091 CCAGTGCCGGCTCTGCTTTGGGG + Intronic
1069106124 10:64385149-64385171 CCAGTGGGGGCTCTGTGTTGGGG + Intergenic
1069915671 10:71785205-71785227 CCCGTTCCTGCACTGGGATGAGG + Intronic
1070780177 10:79132975-79132997 CCCTCGCAGGCTCTGGGGTGGGG + Intronic
1071470758 10:85982585-85982607 CCCGTGGCAGCTCTGTGATGTGG + Intronic
1073116196 10:101093330-101093352 ACCGTGCCAGCTCTGGGGGGCGG - Intronic
1076600311 10:131653163-131653185 CCCGTCCAGCCTCTGGGGTGTGG - Intergenic
1076687463 10:132204534-132204556 CTCGTCCCTGCTCTGGGTTCCGG - Intronic
1077224567 11:1434502-1434524 CCTGGGCCGGCTCTGGGTGTCGG + Intronic
1077389020 11:2290773-2290795 CCTGAGCCAGCTCTGGGTGGTGG - Intergenic
1081678923 11:44988299-44988321 CCCATGCCAGCTCTGGGGTCAGG - Intergenic
1084757324 11:71248087-71248109 CCAGGGCAGGCTCTGGGTAGTGG + Intronic
1087760899 11:102103521-102103543 CCCTTGCCTACTCTGGGGTGGGG + Intergenic
1096581757 12:52590276-52590298 CCTGAGCCCGATCTGGGTTGTGG + Intronic
1098223580 12:68297499-68297521 CCCCTGATGGCTCTGGGTTTGGG + Intronic
1100372499 12:93981316-93981338 CCAGTGTGGACTCTGGGTTGGGG - Intergenic
1102261412 12:111445629-111445651 CCCGGGCCTGCTCTGGTTGGCGG - Intronic
1102375689 12:112419225-112419247 CCCGCCCCGGGTCGGGGTTGGGG + Intronic
1112924833 13:104661219-104661241 CCCTTGGCAACTCTGGGTTGAGG + Intergenic
1113555377 13:111229830-111229852 CAGGTGCGGGCTCTGGGTTTTGG + Intronic
1115203061 14:30874408-30874430 CCCCTGCCGGCCCCGGGGTGAGG - Intergenic
1121359061 14:93239286-93239308 CCAGTGCCCGCTGTGCGTTGAGG - Exonic
1121393503 14:93596938-93596960 CCAGTACTGGCTCTGGGTTCTGG - Intronic
1123059636 14:105588692-105588714 CCAGTTCCTGCTCTGGGTGGGGG + Intergenic
1123880768 15:24676117-24676139 GTCCTGCCGGCTGTGGGTTGGGG + Exonic
1124413026 15:29452272-29452294 CTCTTGCCTGCTCTGGGATGGGG - Intronic
1125767306 15:42144361-42144383 CCAGTGCTGGCTTTGGGCTGGGG - Intronic
1132512585 16:352005-352027 CGCGTGCCGGGTCCGGGTCGGGG - Intronic
1132725848 16:1338078-1338100 CCCGTGCCGACTCTGGGGCCAGG - Intronic
1134167339 16:11941326-11941348 ACCGGGCCGGATCTGAGTTGGGG + Intronic
1134493354 16:14712355-14712377 CCGGGGCCGGATCTGAGTTGGGG - Intronic
1134498735 16:14751479-14751501 CCGGGGCCGGATCTGAGTTGGGG - Intronic
1134525290 16:14938109-14938131 ACCGGGCCGGATCTGAGTTGGGG - Intronic
1134581838 16:15377606-15377628 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1134720744 16:16379911-16379933 ACCGGGCCGGATCTGAGTTGGGG - Intronic
1134946683 16:18331974-18331996 ACCGGGCCGGATCTGAGTTGGGG + Intronic
1135312767 16:21418968-21418990 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1135365684 16:21851238-21851260 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1135446124 16:22519914-22519936 CCGGGGCCGGATCTGAGTTGGGG - Intronic
1136168145 16:28470523-28470545 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1136211169 16:28758597-28758619 CCGGGGCCGGATCTGAGTTGGGG - Intronic
1136322884 16:29499482-29499504 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1136437568 16:30239450-30239472 CCGGGGCCGGATCTGAGTTGGGG + Intronic
1136760595 16:32728306-32728328 CCCCTCACGGCTCTGGGCTGAGG + Intergenic
1136807508 16:33142080-33142102 CCCCTCACGGCTCTGGGCTGAGG - Intergenic
1138205401 16:55120678-55120700 CCCTTGCCTGCTCTGAGCTGAGG - Intergenic
1138651664 16:58464396-58464418 CGCGGCCCGGCTCTGGGTGGCGG - Exonic
1139463699 16:67142605-67142627 CCGGTGCCTGCTCTGGGGAGGGG - Intronic
1140905649 16:79406891-79406913 CCCCTACTGGCTCTGGGATGTGG - Intergenic
1141254301 16:82386429-82386451 CCACTGGTGGCTCTGGGTTGAGG + Intergenic
1203062748 16_KI270728v1_random:988621-988643 CCCCTCACGGCTCTGGGCTGAGG + Intergenic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1144341015 17:14310327-14310349 TCAGTGCCTGCTCTGGGTAGGGG - Intronic
1148795337 17:50194281-50194303 CCCGTGTAGGGTCTGGGATGAGG - Intronic
1151179996 17:72320433-72320455 CCAGTCCTGGCTCTGGGGTGGGG - Intergenic
1152386366 17:79977254-79977276 ACCGGGCCGTCTCTGGGATGGGG - Intronic
1152528960 17:80905825-80905847 GCCGTGCCTGCCCTGGGTTCCGG + Intronic
1152553293 17:81040468-81040490 CCCTTTCTGCCTCTGGGTTGAGG - Intronic
1152600369 17:81259258-81259280 GCAGTGCCGGCTCTGGCTGGGGG - Intronic
1152644994 17:81464784-81464806 CCCCTCCCTGCTCTGGGTGGAGG - Exonic
1156356784 18:36348947-36348969 TCCCTGTCGGCTGTGGGTTGAGG + Intronic
1158961423 18:62590981-62591003 GCTGTGCCAGCTCTGGGTTGAGG - Intergenic
1160201738 18:76801894-76801916 CCTGAGTCGGCTCTGGGGTGTGG + Intronic
1160240477 18:77119161-77119183 CCCCTGCCTGTTCTGGGCTGGGG - Intronic
1160932074 19:1575570-1575592 CCCATGCCAGGTCTGGGTTCTGG + Intronic
1161151405 19:2712030-2712052 CCCCAGCCTGCTCTGGGTTAGGG + Intergenic
1161979083 19:7621183-7621205 CCCGTGCCCGCTCCAGCTTGCGG + Exonic
1164086103 19:21903988-21904010 CCAGTGCAGACTCTGTGTTGGGG + Intergenic
1166014898 19:39972256-39972278 CCTGTGCAAGGTCTGGGTTGGGG - Intronic
1166252059 19:41577982-41578004 CCTGTGCCAGGGCTGGGTTGTGG + Intronic
1166255590 19:41601958-41601980 CCTGTGCCGGGGCTGGGTTGAGG + Intronic
1166361810 19:42255635-42255657 CCCATTCAGGCTCAGGGTTGGGG - Intergenic
1166435444 19:42763459-42763481 CCTGTGCTGGGGCTGGGTTGTGG - Intronic
1166448303 19:42877455-42877477 CCTGTGCTGGGACTGGGTTGTGG - Intronic
1166452707 19:42915667-42915689 CCTGTGCCAGGACTGGGTTGTGG - Intronic
1166471113 19:43080423-43080445 CCTGTGCCAGGGCTGGGTTGTGG - Intronic
1166482266 19:43184326-43184348 CCTGTGCCAGTGCTGGGTTGTGG - Intronic
1166491869 19:43267327-43267349 CCTGTGCCAGTGCTGGGTTGTGG - Intronic
1166495849 19:43302711-43302733 CCTGTGCCAGGGCTGGGTTGTGG - Intergenic
1168399585 19:56077381-56077403 TCCGTGCCTGCCATGGGTTGCGG - Intergenic
927510870 2:23642963-23642985 CCACTGCAGCCTCTGGGTTGGGG - Intronic
928259596 2:29754987-29755009 TTCCTGCCGGCTCTGGGGTGGGG - Intronic
929576108 2:43053563-43053585 CCGTTGCCTGCTCTGGGATGGGG - Intergenic
931198768 2:60077227-60077249 CTGCTGCCTGCTCTGGGTTGTGG - Intergenic
944599542 2:201289597-201289619 CCCTGGATGGCTCTGGGTTGGGG - Intronic
1168827442 20:823253-823275 CCTGTGCCAGCCCTGGGTAGAGG + Intergenic
1170938576 20:20830220-20830242 CCCGTGGGGACTCTGTGTTGGGG - Intergenic
1173662906 20:44746241-44746263 CCCGGGGCGCCTCTGGGTTTCGG + Intronic
1176097138 20:63349401-63349423 CCGGTGCCGTCTCTGGCTTTGGG - Intronic
1179547818 21:42124351-42124373 CCCGTGCCGGCTCTGGGTTGGGG + Intronic
1180699721 22:17774566-17774588 CCCGCGCCGGCGCGGGGCTGTGG + Intronic
1181030225 22:20145945-20145967 CCCTGGCCTGCTCTGGGTGGTGG + Intronic
1182857946 22:33534692-33534714 CCAGTGCTGGTTCTGGGTTTGGG + Intronic
1183380270 22:37487165-37487187 CCAGTGCAGGCTCTGAGTGGAGG - Intergenic
1184322668 22:43754394-43754416 CCCCTGCCTGCCCAGGGTTGGGG + Intronic
1184488358 22:44795273-44795295 CCAGTGTGGGCTCTGGGCTGGGG + Intronic
1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG + Exonic
1185385152 22:50528505-50528527 CCCGTACCTGCTCTGGGCTCTGG + Exonic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
961662500 3:128477053-128477075 CCAGGGCTGGCTCTGGGTTCTGG + Intergenic
962736438 3:138329603-138329625 CCCTGGCCGGCTCCGGGGTGGGG - Intronic
968380963 4:95470-95492 CCCCTGCACCCTCTGGGTTGGGG + Intergenic
968500514 4:947751-947773 CCAGTGCCTGCTCTGGGGTCCGG - Exonic
969273971 4:6122638-6122660 CAAGTGCCGGCTCTAGGATGCGG + Intronic
969330608 4:6471932-6471954 CCTGTGCCGGCGCTGGGCAGCGG + Intronic
969428479 4:7139426-7139448 CCCGTGCGGTGTCTGGGCTGTGG + Intergenic
982484741 4:155953644-155953666 CCTGTCCCGGGTCTGGGCTGCGG - Intronic
992561550 5:77957761-77957783 CGCGTCCCGGCGCTGGGTTTGGG - Intergenic
997605017 5:135168690-135168712 CCCATGCCTGTTCTGGGCTGTGG + Intronic
998406265 5:141876354-141876376 CTCGCGCCGGCTCCGGCTTGCGG - Intronic
1002723971 5:181282608-181282630 CCCGTGGCGGGGATGGGTTGTGG + Intergenic
1003811664 6:9789337-9789359 CCCCTGGCGCCTCTGGGTTAGGG - Intronic
1007162564 6:39803748-39803770 CCTGTGCAGGCTGTGGGGTGGGG + Intronic
1007484100 6:42168715-42168737 TCCCTGCCAGCTCAGGGTTGGGG - Intronic
1012490703 6:99780066-99780088 GCAGTGCTGGCTCTGGGGTGGGG + Intergenic
1013099529 6:106974990-106975012 CCCGCGCCGGCTGCGGGCTGCGG + Intronic
1024919427 7:54542379-54542401 CCCGAGCCGGCTCCGTGTTTAGG + Exonic
1034848815 7:154474445-154474467 CCCTGGCTGTCTCTGGGTTGTGG - Intronic
1037273744 8:17156546-17156568 GCCGCGCCGGCTCGGGGCTGCGG + Exonic
1042480221 8:69294564-69294586 CCAGTGGTAGCTCTGGGTTGTGG + Intergenic
1043453491 8:80391916-80391938 TCCCTGGCTGCTCTGGGTTGAGG + Intergenic
1044366962 8:91358917-91358939 CCAGGGCCGGTTGTGGGTTGGGG + Intronic
1046357681 8:113109641-113109663 CCCGTGACAGTTCTGTGTTGTGG + Intronic
1047523755 8:125615426-125615448 CTCTTGCCTGCTCTGGGATGGGG + Intergenic
1057279550 9:93699921-93699943 CCACTTCCAGCTCTGGGTTGAGG - Intergenic
1062551565 9:137089825-137089847 GCTGTGCAGGCTCTGGCTTGGGG + Intronic
1062558318 9:137127355-137127377 GCTGTGCAGGCTCTGGCTTGGGG - Intergenic
1185737022 X:2501999-2502021 CCCCTGCAGGGTCTGGGTAGGGG - Intronic
1185778839 X:2828934-2828956 CCAGCGCCGGCTCTGGGCCGAGG + Exonic
1190735153 X:53250944-53250966 CTCGGGCCGGCCCTGGGGTGGGG + Exonic
1192344631 X:70290675-70290697 CCCGTGCCTTCTCTAGGTGGTGG + Exonic
1200090684 X:153634479-153634501 CCCGGCCTGGCTCTGGGATGGGG - Intergenic