ID: 1179549560

View in Genome Browser
Species Human (GRCh38)
Location 21:42135437-42135459
Sequence CAGTTGCCACCTCTCCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179549560_1179549565 0 Left 1179549560 21:42135437-42135459 CCTAGCTGGAGAGGTGGCAACTG No data
Right 1179549565 21:42135460-42135482 AACAGGGATGGGTCTTTCCCAGG No data
1179549560_1179549572 25 Left 1179549560 21:42135437-42135459 CCTAGCTGGAGAGGTGGCAACTG No data
Right 1179549572 21:42135485-42135507 TGAGAGTCCAGGGCCATTCCGGG No data
1179549560_1179549566 1 Left 1179549560 21:42135437-42135459 CCTAGCTGGAGAGGTGGCAACTG No data
Right 1179549566 21:42135461-42135483 ACAGGGATGGGTCTTTCCCAGGG No data
1179549560_1179549571 24 Left 1179549560 21:42135437-42135459 CCTAGCTGGAGAGGTGGCAACTG No data
Right 1179549571 21:42135484-42135506 CTGAGAGTCCAGGGCCATTCCGG No data
1179549560_1179549567 14 Left 1179549560 21:42135437-42135459 CCTAGCTGGAGAGGTGGCAACTG No data
Right 1179549567 21:42135474-42135496 TTTCCCAGGGCTGAGAGTCCAGG No data
1179549560_1179549568 15 Left 1179549560 21:42135437-42135459 CCTAGCTGGAGAGGTGGCAACTG No data
Right 1179549568 21:42135475-42135497 TTCCCAGGGCTGAGAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179549560 Original CRISPR CAGTTGCCACCTCTCCAGCT AGG (reversed) Intronic