ID: 1179549565 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:42135460-42135482 |
| Sequence | AACAGGGATGGGTCTTTCCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1179549560_1179549565 | 0 | Left | 1179549560 | 21:42135437-42135459 | CCTAGCTGGAGAGGTGGCAACTG | 0: 1 1: 0 2: 1 3: 20 4: 214 |
||
| Right | 1179549565 | 21:42135460-42135482 | AACAGGGATGGGTCTTTCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1179549565 | Original CRISPR | AACAGGGATGGGTCTTTCCC AGG | Intronic | ||