ID: 1179549565

View in Genome Browser
Species Human (GRCh38)
Location 21:42135460-42135482
Sequence AACAGGGATGGGTCTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179549560_1179549565 0 Left 1179549560 21:42135437-42135459 CCTAGCTGGAGAGGTGGCAACTG No data
Right 1179549565 21:42135460-42135482 AACAGGGATGGGTCTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179549565 Original CRISPR AACAGGGATGGGTCTTTCCC AGG Intronic