ID: 1179550932

View in Genome Browser
Species Human (GRCh38)
Location 21:42143325-42143347
Sequence GGAGGCCAGAAACGCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179550924_1179550932 11 Left 1179550924 21:42143291-42143313 CCAACGAGGGCCGGTGCTGTGTT 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1179550932 21:42143325-42143347 GGAGGCCAGAAACGCATCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 111
1179550927_1179550932 1 Left 1179550927 21:42143301-42143323 CCGGTGCTGTGTTGGGCACGCTG 0: 1
1: 0
2: 11
3: 20
4: 173
Right 1179550932 21:42143325-42143347 GGAGGCCAGAAACGCATCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179550932 Original CRISPR GGAGGCCAGAAACGCATCTC TGG Intronic
901144715 1:7057128-7057150 GGAGCCCAGACCCCCATCTCAGG - Intronic
902562511 1:17286633-17286655 GGAGGCCAGAAACGGCAGTCAGG - Intergenic
903153702 1:21430262-21430284 GAAGGCCGGAAATGCAGCTCGGG - Intergenic
905822490 1:41004445-41004467 GGAGACCAGAAAGCCAGCTCTGG - Intronic
907276781 1:53321245-53321267 GGGGTCTAGAAAGGCATCTCTGG + Intronic
907294364 1:53439958-53439980 GGACTCCAGAAAGGCCTCTCAGG - Intergenic
911525457 1:98979661-98979683 GGAGGCCAGAAATCCATCGCAGG - Intronic
912882254 1:113427262-113427284 TGAGGCCAAAGATGCATCTCAGG + Intronic
913690950 1:121279316-121279338 GGAGGAAAGAAAGGGATCTCTGG + Intronic
914146590 1:145000647-145000669 GGAGGAAAGAAAGGGATCTCTGG - Intronic
920478272 1:206297791-206297813 GGAGGAAAGAAAGGGATCTCTGG + Intronic
923027264 1:230215216-230215238 GGAGGCCAGAAATGGACTTCAGG - Intronic
1067469338 10:46524695-46524717 GGAGCCCAGGAACCCACCTCGGG + Intergenic
1069657255 10:70099113-70099135 GGGGGCCAGAAAGGAGTCTCAGG + Intronic
1071576407 10:86729915-86729937 GGAAGACAGAAAGGCATCTCTGG - Intronic
1073432375 10:103494576-103494598 GGAGGCCGGAGATGCACCTCTGG + Intronic
1076628949 10:131841362-131841384 TGAGGCCACAGAGGCATCTCAGG + Intergenic
1077136791 11:1003612-1003634 GGAGGCCAGAAAAACCTCTATGG - Intronic
1077767213 11:5172202-5172224 GGAGGCCAGAAATGGAATTCAGG + Intronic
1078210575 11:9266204-9266226 AGAGGCCAGAAAGGCAACACAGG + Intergenic
1079164341 11:18024894-18024916 GGAAGGAAGAAATGCATCTCAGG - Intronic
1080503842 11:32893377-32893399 GAAGGCCCCAAACGCATCCCCGG - Intronic
1085451689 11:76637792-76637814 GGAGGCCAGAAGCACAACCCCGG - Intergenic
1089255527 11:117192127-117192149 GGGGCCCAGGAAGGCATCTCAGG - Intronic
1089634430 11:119803337-119803359 GGAGGCCAGAAACTGGCCTCGGG - Intergenic
1098378038 12:69838111-69838133 GGAGGACAGAAAGGCATTGCTGG + Intronic
1099162194 12:79256335-79256357 GGAGCCCAAAAAGGAATCTCAGG + Intronic
1101209017 12:102517658-102517680 AGAGGCCAGAAACTTATTTCTGG + Intergenic
1102864733 12:116365297-116365319 GGAGGGCAGAAGGGTATCTCAGG - Intergenic
1104190611 12:126479162-126479184 GGAGGCCAGAAACCCTTCCCTGG - Intergenic
1104238266 12:126960950-126960972 GGAGCCCAGAAACGCTGCCCAGG - Intergenic
1107460472 13:40597300-40597322 GGTGACCAGGAACTCATCTCTGG - Intronic
1111429145 13:88129377-88129399 GGGGAGCAGAAACTCATCTCTGG + Intergenic
1122033429 14:98930252-98930274 AGATGCCAGAAACACATCACTGG + Intergenic
1122127620 14:99587675-99587697 TGAGGGCAGCCACGCATCTCAGG + Intronic
1129449265 15:75640931-75640953 GGTGGCCAGAAATTCATGTCAGG - Intronic
1131738266 15:95357951-95357973 GGAGGCCACAAGTGCATCACTGG + Intergenic
1132276395 15:100568590-100568612 GGAGGCCAGAATCCAAACTCAGG - Exonic
1132609503 16:808251-808273 GGAGGCCTCAAAACCATCTCTGG - Intronic
1135228209 16:20680201-20680223 GTAGACCAGAAAGGTATCTCTGG - Intronic
1135390943 16:22092701-22092723 GGAGGCCAGATACTAAGCTCTGG + Intronic
1139391500 16:66608695-66608717 GGTGGCCAGAGACCCCTCTCCGG - Intronic
1140866561 16:79067457-79067479 GGAGCCGAGAAGAGCATCTCAGG - Intronic
1142214245 16:88822985-88823007 GCATGCCAGCTACGCATCTCGGG - Intronic
1143978691 17:10849216-10849238 TCAGTCCAGAAATGCATCTCTGG + Intergenic
1145010418 17:19364728-19364750 GGAGCCCAGGAAGGCATCTGGGG - Intronic
1147452978 17:40517609-40517631 GGAGGCCAGAGAGGCACCTAGGG + Intergenic
1160701755 19:510878-510900 GGAGGCCAGGGACGCTGCTCAGG - Intronic
1161518965 19:4713108-4713130 GGAGGCCAGGAACGCTGCTCAGG + Intronic
1162461418 19:10816281-10816303 TGAGGCCAGACGCTCATCTCTGG + Intronic
1163746589 19:19052413-19052435 GCAGGCCACAATCCCATCTCTGG + Intronic
1165389179 19:35528529-35528551 GAAGGGCAGACACCCATCTCTGG - Intergenic
1168705620 19:58468747-58468769 GGAGGCCAAGAAGGCATCTGGGG + Intronic
927107883 2:19843502-19843524 GGAGGCCAGATCCGTCTCTCAGG - Intergenic
931923669 2:67047744-67047766 GGAGTCAAGAAATGCATGTCTGG - Intergenic
934720633 2:96573341-96573363 GGAAGACAGAAACGCATGTTTGG + Intergenic
936031982 2:109079853-109079875 GGAGGCCTGAAACACATCACAGG + Intergenic
936048649 2:109206043-109206065 GGAGGCTGGAAAGGCATCTCAGG - Intronic
942905263 2:181173341-181173363 GGCAGCCAGAAACCCATCTGGGG - Intergenic
946117625 2:217477404-217477426 GGGGTACAGAAAAGCATCTCTGG + Intronic
1173553664 20:43950457-43950479 GGAGGCCAGAGAGGCAACTGGGG - Intronic
1175731306 20:61355823-61355845 GGTGGCCTGAAAGGCTTCTCAGG - Intronic
1176262786 20:64191442-64191464 AGAGGTCAGAATCGGATCTCTGG - Intronic
1179104729 21:38388774-38388796 GGAGACCGGAAACTCATCACAGG - Intronic
1179550932 21:42143325-42143347 GGAGGCCAGAAACGCATCTCTGG + Intronic
1180193611 21:46181095-46181117 GGAGGACAGCAACGCAGCCCGGG + Intronic
1181009760 22:20033286-20033308 GAAGGCCATAAACAGATCTCCGG - Intronic
1181113498 22:20616310-20616332 GGAGGTCAGAAACTCTGCTCCGG - Intergenic
1181968564 22:26673189-26673211 GCCGGCCAGGAATGCATCTCTGG + Intergenic
954115864 3:48466536-48466558 GGTGGGCAGAAGCACATCTCAGG - Intronic
954164002 3:48741504-48741526 TGAGGCCAGAAATGCATTGCTGG + Intergenic
955348992 3:58180304-58180326 GAAGGCCAGAAAAGCAACTCAGG + Intergenic
956158849 3:66326470-66326492 GGAGGCCAGCAAAGCCTCTGGGG - Intronic
958723351 3:97873732-97873754 GGAGCCCAGAAACATTTCTCAGG + Exonic
959704884 3:109330588-109330610 GGAGGCCAGCAAAGCCTCTGGGG + Exonic
960950243 3:122994349-122994371 GGAGGCCAGGACCCCATCTATGG + Intronic
960984582 3:123267479-123267501 GGAGGGCAAAAACACATCTAGGG - Intronic
961035264 3:123637683-123637705 GGAGGCCAGGGGCGAATCTCTGG - Intronic
962118987 3:132542081-132542103 GGAGGCCAGAACCACAGCCCAGG - Intergenic
962281736 3:134057314-134057336 GAGGGCCAGGAAGGCATCTCTGG + Intergenic
962334136 3:134510802-134510824 GGAGGCCAGCAAAGCACCTGGGG + Intronic
964211326 3:154231722-154231744 GGAGGCCATAAATTCATGTCTGG - Intronic
967957008 3:194885082-194885104 AGAGACCAGAAACCCACCTCTGG + Intergenic
969322887 4:6423803-6423825 AGAGGCCAGAAAGGCAGGTCAGG + Intronic
969927603 4:10599873-10599895 GGAGGCCAGGAAAGCAGCTAGGG - Intronic
985912316 5:2894080-2894102 AGAGGGCAGAAAAGGATCTCGGG - Intergenic
985978084 5:3437979-3438001 GGAGTGCAGAAAGGCATCACAGG + Intergenic
986782258 5:11077358-11077380 GGTGGCCTGAAAAGCTTCTCTGG + Intronic
986944150 5:12994685-12994707 GGAGGCCAGAAACCTATGTCTGG - Intergenic
990594600 5:57300256-57300278 TGAGCCCAGAAGTGCATCTCTGG + Intergenic
995574058 5:113511534-113511556 GAAGGCCAGAGAGGCAGCTCAGG - Intergenic
997036200 5:130194833-130194855 GGTGGTCAGAAAAGCCTCTCTGG - Intergenic
1000138354 5:158376846-158376868 GTAGGCCAGAAACACCTCTGGGG - Intergenic
1001573270 5:172744697-172744719 GGTGGCCAGAAAGGCAGGTCGGG - Intergenic
1002957811 6:1885161-1885183 GGAGTCCAAAATGGCATCTCTGG - Intronic
1002959726 6:1903806-1903828 GGAGGACAGAAAGGCATCCAGGG - Intronic
1005053059 6:21702968-21702990 GGAAGACAGGAAAGCATCTCAGG + Intergenic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1006400942 6:33817010-33817032 GGAGGGCAAACACGCATGTCAGG + Intergenic
1007266320 6:40599027-40599049 GGAGGCCAGAAATTCAGCTAGGG + Intergenic
1007498850 6:42280330-42280352 GGAGGCCAGAACCGGATCCTCGG - Intronic
1008386402 6:50896367-50896389 GGAGGCCAGAAGCCCAAATCTGG - Intergenic
1014885324 6:126773545-126773567 AGAGGGCAGAAACCCAGCTCCGG + Intergenic
1018441765 6:163820286-163820308 TCAGGCCAGAAACGCATCCGTGG - Intergenic
1019733176 7:2638465-2638487 GGAGGCCAGAGAGGCAGCCCTGG - Intronic
1030423483 7:109339831-109339853 GGAGTCCTGGAACGTATCTCTGG - Intergenic
1032515784 7:132505075-132505097 GGAGGCCAGAAACTCTGCACAGG - Intronic
1035253439 7:157611991-157612013 GGAGGCCAGAAATGGAGGTCAGG - Intronic
1039399947 8:37261011-37261033 GGAGGACAGAGATGCAGCTCAGG - Intergenic
1039425871 8:37485559-37485581 GGAGGGCAGAACCCCATCTCAGG + Intergenic
1039426161 8:37488027-37488049 GGAGGGCAGAATCCCATCTCAGG + Intergenic
1039791396 8:40878752-40878774 CGAGGCCAGAGCTGCATCTCTGG - Intronic
1046176702 8:110584519-110584541 AGTGGCCAAAAACGCAGCTCCGG - Intergenic
1048050810 8:130814300-130814322 GGAGGCAGGAAAGGCTTCTCTGG + Intronic
1050136757 9:2473507-2473529 GGAGGCCAGAAGTGTAGCTCTGG - Intergenic
1185466929 X:360772-360794 GGGGTCCAGACACGCATCTCTGG + Intronic
1187089128 X:16075708-16075730 GGAGGCCTGAATCACATATCTGG + Intergenic
1191184141 X:57592228-57592250 GGAGGCCAGCACGGCATCACGGG + Exonic
1191213247 X:57910219-57910241 GGAGGCCAGCACGGCATCACGGG - Exonic
1195982092 X:110590375-110590397 GGAGCCCTGAAAATCATCTCTGG - Intergenic