ID: 1179557173

View in Genome Browser
Species Human (GRCh38)
Location 21:42187131-42187153
Sequence TGGCAGGGTCAGGGTCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179557160_1179557173 14 Left 1179557160 21:42187094-42187116 CCAGTTCCAGAGCCTGGGAAGTG No data
Right 1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG No data
1179557159_1179557173 15 Left 1179557159 21:42187093-42187115 CCCAGTTCCAGAGCCTGGGAAGT No data
Right 1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG No data
1179557164_1179557173 2 Left 1179557164 21:42187106-42187128 CCTGGGAAGTGTGAGATCAGGGT No data
Right 1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG No data
1179557161_1179557173 8 Left 1179557161 21:42187100-42187122 CCAGAGCCTGGGAAGTGTGAGAT No data
Right 1179557173 21:42187131-42187153 TGGCAGGGTCAGGGTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179557173 Original CRISPR TGGCAGGGTCAGGGTCTGGT GGG Intergenic
No off target data available for this crispr