ID: 1179558455

View in Genome Browser
Species Human (GRCh38)
Location 21:42195466-42195488
Sequence CCTGACTGTCAGTCACAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179558448_1179558455 8 Left 1179558448 21:42195435-42195457 CCAAGTCGTTTGTGGAAAAGGAA No data
Right 1179558455 21:42195466-42195488 CCTGACTGTCAGTCACAGGCCGG No data
1179558443_1179558455 22 Left 1179558443 21:42195421-42195443 CCCAAGACAGGTTCCCAAGTCGT No data
Right 1179558455 21:42195466-42195488 CCTGACTGTCAGTCACAGGCCGG No data
1179558444_1179558455 21 Left 1179558444 21:42195422-42195444 CCAAGACAGGTTCCCAAGTCGTT No data
Right 1179558455 21:42195466-42195488 CCTGACTGTCAGTCACAGGCCGG No data
1179558447_1179558455 9 Left 1179558447 21:42195434-42195456 CCCAAGTCGTTTGTGGAAAAGGA No data
Right 1179558455 21:42195466-42195488 CCTGACTGTCAGTCACAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179558455 Original CRISPR CCTGACTGTCAGTCACAGGC CGG Intergenic
No off target data available for this crispr