ID: 1179559700

View in Genome Browser
Species Human (GRCh38)
Location 21:42207604-42207626
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179559692_1179559700 25 Left 1179559692 21:42207556-42207578 CCTCTTTGCATTGGCATGCATTG No data
Right 1179559700 21:42207604-42207626 TCTCTGACATCACTGTGGGAGGG No data
1179559696_1179559700 -10 Left 1179559696 21:42207591-42207613 CCATTAATTGGCTTCTCTGACAT No data
Right 1179559700 21:42207604-42207626 TCTCTGACATCACTGTGGGAGGG No data
1179559695_1179559700 -6 Left 1179559695 21:42207587-42207609 CCATCCATTAATTGGCTTCTCTG No data
Right 1179559700 21:42207604-42207626 TCTCTGACATCACTGTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type