ID: 1179559707 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:42207638-42207660 |
Sequence | GGCACTGCCACCTTACTACC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1179559696_1179559707 | 24 | Left | 1179559696 | 21:42207591-42207613 | CCATTAATTGGCTTCTCTGACAT | No data | ||
Right | 1179559707 | 21:42207638-42207660 | GGCACTGCCACCTTACTACCAGG | No data | ||||
1179559695_1179559707 | 28 | Left | 1179559695 | 21:42207587-42207609 | CCATCCATTAATTGGCTTCTCTG | No data | ||
Right | 1179559707 | 21:42207638-42207660 | GGCACTGCCACCTTACTACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1179559707 | Original CRISPR | GGCACTGCCACCTTACTACC AGG | Intronic | ||