ID: 1179559707

View in Genome Browser
Species Human (GRCh38)
Location 21:42207638-42207660
Sequence GGCACTGCCACCTTACTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179559696_1179559707 24 Left 1179559696 21:42207591-42207613 CCATTAATTGGCTTCTCTGACAT 0: 1
1: 0
2: 1
3: 17
4: 212
Right 1179559707 21:42207638-42207660 GGCACTGCCACCTTACTACCAGG 0: 1
1: 0
2: 0
3: 14
4: 111
1179559695_1179559707 28 Left 1179559695 21:42207587-42207609 CCATCCATTAATTGGCTTCTCTG 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1179559707 21:42207638-42207660 GGCACTGCCACCTTACTACCAGG 0: 1
1: 0
2: 0
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179559707 Original CRISPR GGCACTGCCACCTTACTACC AGG Intronic
900599650 1:3497539-3497561 GCCCCTGCCACCTTGCCACCGGG - Intronic
900967328 1:5967778-5967800 GGCACTGCCTCCCTGCTCCCTGG - Intronic
904843355 1:33388892-33388914 GGCACTCCCACGTTACAACCTGG - Intronic
908201263 1:61798266-61798288 CTCACTGCCGCCTTACTTCCTGG + Intronic
908745084 1:67368701-67368723 GGCTCTGCAGCCATACTACCTGG + Intronic
910051585 1:82980396-82980418 GTAACTGCCACCTTGCTACTGGG + Intergenic
912631431 1:111249685-111249707 GGCTCTGCCACCTTACGAGTTGG + Intergenic
914408318 1:147400114-147400136 GGCACTGCCTTATTACTGCCAGG + Intergenic
917703806 1:177611326-177611348 AAGTCTGCCACCTTACTACCTGG + Intergenic
920358205 1:205391737-205391759 GGCACTGCCTCTTTGCTGCCAGG - Intronic
922273133 1:224052906-224052928 GACACTGACACCTGACTCCCTGG + Intergenic
922668077 1:227489753-227489775 GGCACTGCGTCCTTACTAGCTGG - Intergenic
1074974996 10:118572827-118572849 GGCACTGCCTCATTACTGCTAGG - Intergenic
1077673565 11:4179160-4179182 GTCACTGCCACCCTGCTACTGGG + Intergenic
1078101826 11:8334548-8334570 GGCACTGCCGCCTGGCTTCCTGG - Intergenic
1079701183 11:23550840-23550862 GGCACTGTATCTTTACTACCAGG + Intergenic
1080917374 11:36673676-36673698 GACACTTCCACCTTAATACTGGG + Intergenic
1083363496 11:62127784-62127806 GGCACTGCCATCTGTCTTCCTGG - Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1086351831 11:85950143-85950165 GGCTCTGCTCCTTTACTACCTGG - Intergenic
1088218019 11:107535451-107535473 TGCAATGCCACCTTACTCCTGGG - Intronic
1088778973 11:113115106-113115128 GGCACAGCCACCTTGCTCCCAGG - Intronic
1088914122 11:114214168-114214190 GGCACTGTCCCCTTACTATGGGG - Intronic
1089969161 11:122678584-122678606 GGCACTGCCACCATCATCCCAGG + Intronic
1091747963 12:3004523-3004545 GGCACTGGCACCAGACTACATGG + Intronic
1093552818 12:20435619-20435641 CGCATGGCCTCCTTACTACCAGG - Intronic
1095663369 12:44764655-44764677 GGTGCTGCCACTTTACTAGCTGG + Intronic
1102637790 12:114339491-114339513 GGCACTGAGAGCTTAGTACCTGG + Intergenic
1103440083 12:120956616-120956638 GGGGCTGCCACCTTCCTGCCAGG - Intergenic
1105249547 13:18685617-18685639 GCCACTGCCACATCACTGCCTGG - Intergenic
1112186918 13:97136639-97136661 GGCACTCCCACATTTCTCCCTGG + Intergenic
1121119099 14:91364662-91364684 GCCCCTGCCACCTTCCTGCCGGG - Intronic
1125340731 15:38672956-38672978 AGCTCTGCCCCCTTACTAACAGG + Intergenic
1126158548 15:45587482-45587504 GACACGGCCACCCTACTGCCTGG + Exonic
1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG + Intronic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1129737026 15:77972269-77972291 GGCCCTGCTACCTGACTCCCAGG - Intergenic
1130392638 15:83472870-83472892 GGCACTGCCTTGTTACTTCCAGG + Intronic
1135204041 16:20467248-20467270 GGCACTGCCAGTTTAGCACCTGG - Intronic
1138521942 16:57576081-57576103 GGCCCTGCCACCTTCCTCCAGGG + Exonic
1140172144 16:72616970-72616992 GGCTCTGCCATTTTACTAGCTGG - Intergenic
1142278085 16:89133416-89133438 GGCACTGCCTCCTGAGCACCCGG + Intronic
1149389269 17:56173232-56173254 GGCTCTGCCACTTTGCCACCTGG + Intronic
1150916358 17:69441783-69441805 GGTGCTGCCTCCTTACTGCCAGG + Intronic
1151473493 17:74332247-74332269 GGAGCTCCCACCTTACTTCCAGG - Intronic
1154439282 18:14373268-14373290 GCCACTGCCACATCACTGCCAGG + Intergenic
1156460712 18:37319925-37319947 GGCTGTCCCATCTTACTACCTGG + Intronic
1162140568 19:8583193-8583215 GGCACTGCAACCAAACTACCTGG - Intronic
1164770575 19:30805591-30805613 GGCACTGCCTCCTTAGAACCAGG - Intergenic
926588565 2:14715972-14715994 GGGACAGCCACCTTCTTACCTGG + Intergenic
927998786 2:27505740-27505762 GGCACTTCCACCTTTCATCCGGG - Exonic
931138868 2:59435284-59435306 TGCACTGGGAGCTTACTACCGGG + Intergenic
931568330 2:63640377-63640399 GCCACTGCCACCTGAATAGCTGG - Intronic
934530657 2:95085695-95085717 GGCACTGCCTCGTTACTGCCTGG - Intergenic
935558872 2:104540895-104540917 AGCACTGCCTTGTTACTACCAGG + Intergenic
936641614 2:114318138-114318160 GACACTGCCTCATTACTGCCAGG + Intergenic
936706748 2:115084505-115084527 GGCACTGCAATCATAGTACCAGG - Intronic
936713342 2:115159157-115159179 GCCACTTCCACCTTTTTACCTGG - Intronic
938776470 2:134545542-134545564 GGCACTGCCCCCTCACCTCCTGG + Intronic
939744491 2:145952062-145952084 GACACTCCCACCCTAATACCGGG - Intergenic
940587038 2:155665844-155665866 GTCACTGCCACCCTACTAGCTGG - Intergenic
943490227 2:188544076-188544098 TGCACTGCCCCCTTATTGCCTGG - Intronic
944510229 2:200457164-200457186 GGCACTGCTACCTTACTTTAGGG - Intronic
944659878 2:201912594-201912616 GGCTCTGCCACTTCACTAGCTGG - Intergenic
946032765 2:216717989-216718011 GGCCCTGCCCCCTCACCACCAGG - Intergenic
1173513186 20:43646351-43646373 GGCACAGCCAGCTTCCTTCCAGG - Intronic
1174393781 20:50233796-50233818 GGCCCTGCCACCTCTCTCCCTGG - Intergenic
1176456399 21:6916140-6916162 GCCACTGCCACATCACTGCCTGG - Intergenic
1176834574 21:13781200-13781222 GCCACTGCCACATCACTGCCTGG - Intergenic
1177762541 21:25418405-25418427 GGCACTGTCTCCTTATTTCCAGG - Intergenic
1179559707 21:42207638-42207660 GGCACTGCCACCTTACTACCAGG + Intronic
949751523 3:7357603-7357625 TACACTGCCACCTTTCTAGCTGG + Intronic
950892123 3:16413435-16413457 GGCATTGCCACCTTCCTATGGGG + Intronic
951165963 3:19485566-19485588 GGCACAGCTACCTTCCTATCTGG + Intronic
953832430 3:46312102-46312124 GGCACTGCCTCATTACTGCCAGG + Intergenic
954363511 3:50134580-50134602 GGCCCCACCACCTTCCTACCAGG - Intergenic
959908930 3:111741122-111741144 AGCACTGCCAGCTTTCTAGCAGG + Intronic
961627223 3:128272450-128272472 TGAACGGCCACCTTACTCCCAGG + Intronic
966155022 3:176906853-176906875 GGCCATGCCACCTGACAACCAGG + Intergenic
971085885 4:23274491-23274513 GGCACTGCTACCCTATAACCAGG - Intergenic
975312393 4:72917160-72917182 GGCTCTGCAACCATACTCCCTGG - Intergenic
986210537 5:5667468-5667490 GGCAATGCCATCTTCCTGCCTGG + Intergenic
987115712 5:14725145-14725167 GGCACTGGCGCCTGACTGCCGGG + Intronic
989569050 5:42927921-42927943 TGTGCTGCCACCTTACTGCCAGG + Intergenic
992425061 5:76648335-76648357 GGCACTGCCTCATTACTAGGAGG - Intronic
994784711 5:104142747-104142769 GGCATAGCCACCTTATCACCTGG - Intergenic
996723025 5:126648335-126648357 GGAACCACCACCTTACAACCTGG + Intergenic
996776754 5:127140963-127140985 GGCACTGCCTCGTTACTGCCTGG - Intergenic
998236148 5:140400760-140400782 GGCATTCCCACCTTCCTACGTGG + Intergenic
1004718438 6:18242246-18242268 GGCACAGCCACCCTAGTAGCTGG - Intronic
1006845617 6:37059501-37059523 GGCTCTGCTACCTTCCAACCAGG + Intergenic
1007236788 6:40396271-40396293 AGCTCTGCCAACTTACTAGCTGG - Intronic
1008955863 6:57214654-57214676 GGCACTACCTCTTTACTACCAGG - Intronic
1014201212 6:118610644-118610666 GGCACTGTCTCCTTATTGCCAGG - Intronic
1014913759 6:127120715-127120737 GGCACTGCCACCTTTTTAAAAGG - Intronic
1015135987 6:129871398-129871420 GGCACTGTCACCTTTCTGGCCGG - Intergenic
1015724783 6:136289247-136289269 GGGACTGCCACCTTTCTTCGTGG - Intronic
1018698985 6:166412346-166412368 CGCACTGCCACTTTCCCACCGGG + Exonic
1025173229 7:56780417-56780439 GCCTCTGCCACTGTACTACCTGG + Intergenic
1025698874 7:63797764-63797786 GCCTCTGCCACTGTACTACCTGG - Intergenic
1025830588 7:65045784-65045806 GCCTCTGCCACTGTACTACCTGG - Intergenic
1025917742 7:65879570-65879592 GCCTCTGCCACTGTACTACCTGG - Intronic
1035569979 8:666507-666529 AGCACTGCCACCTTCCTGCTGGG + Intronic
1040655215 8:49500138-49500160 GGCACTGCCTCATGACTGCCAGG + Intergenic
1045131148 8:99154658-99154680 GGCCCTGCCACATTAGCACCTGG + Intronic
1046036632 8:108850575-108850597 GGCACTGCCCCATTGCTACCTGG - Intergenic
1046913774 8:119658530-119658552 AGCACTGCCACTTTACTAGCTGG + Intronic
1048776003 8:137947197-137947219 GGCACTGACACCTCATTAACAGG + Intergenic
1054319301 9:63638366-63638388 GTCACTGTCACCTTTATACCAGG + Intergenic
1054877597 9:70112864-70112886 CCCACTGCAACCTTTCTACCAGG - Intronic
1058204496 9:102086538-102086560 GTCTCAGCCTCCTTACTACCTGG + Intergenic
1059253931 9:112911674-112911696 GGCAATGACACCTTCCTTCCAGG + Intergenic
1060211476 9:121713103-121713125 TGCCCTGCCACCTTCCTAGCTGG - Intronic
1061630268 9:131867859-131867881 GGCACTGCCAGCTGACTCCCAGG + Intronic
1188935227 X:36167458-36167480 GGAACTACCACCTTACGAACTGG + Intergenic
1189859412 X:45257789-45257811 GGCACTGCAACCTCTGTACCTGG + Intergenic
1190571489 X:51786836-51786858 GGGAATGCCTCCTTATTACCAGG + Intergenic
1191718431 X:64208909-64208931 GGCTCTGCCACCAGACTGCCTGG + Intergenic
1193070257 X:77298923-77298945 GGCACAGCCACCTTCCCATCTGG - Intergenic
1194284284 X:91990633-91990655 GGCACTGCCTCATTATTTCCAGG + Intronic
1196643350 X:118089467-118089489 GGCACTGCCTCATTACTGCCAGG - Intronic
1196663361 X:118291983-118292005 GGCACTGCCTCATTACTTTCAGG - Intergenic
1196795943 X:119501981-119502003 GGCACTGCCACTCACCTACCTGG - Intergenic
1198163655 X:134032166-134032188 GGCTCTGCCACTTAACTAACTGG + Intergenic
1200076413 X:153553500-153553522 GCCACTGCCACCTTCTCACCTGG - Intronic
1200601852 Y:5215192-5215214 GGCACTGCCTCATTATTTCCAGG + Intronic