ID: 1179561609

View in Genome Browser
Species Human (GRCh38)
Location 21:42219279-42219301
Sequence GGCGGTGCCGACCGAGAAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179561609_1179561613 8 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561613 21:42219310-42219332 TGAGCGCATCCTTCGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1179561609_1179561614 9 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561614 21:42219311-42219333 GAGCGCATCCTTCGTCCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1179561609_1179561619 28 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561619 21:42219330-42219352 CGGGAACGGTTTTATTTTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 75
1179561609_1179561615 14 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561615 21:42219316-42219338 CATCCTTCGTCCGCCGGGAACGG 0: 1
1: 0
2: 0
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179561609 Original CRISPR GGCGGTGCCGACCGAGAAAG CGG (reversed) Exonic