ID: 1179561609

View in Genome Browser
Species Human (GRCh38)
Location 21:42219279-42219301
Sequence GGCGGTGCCGACCGAGAAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179561609_1179561615 14 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561615 21:42219316-42219338 CATCCTTCGTCCGCCGGGAACGG 0: 1
1: 0
2: 0
3: 0
4: 22
1179561609_1179561613 8 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561613 21:42219310-42219332 TGAGCGCATCCTTCGTCCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 29
1179561609_1179561619 28 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561619 21:42219330-42219352 CGGGAACGGTTTTATTTTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 75
1179561609_1179561614 9 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561614 21:42219311-42219333 GAGCGCATCCTTCGTCCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179561609 Original CRISPR GGCGGTGCCGACCGAGAAAG CGG (reversed) Exonic
904608889 1:31714614-31714636 GGCGGTGCCGGCGGGGCAAGCGG - Intergenic
904974205 1:34443267-34443289 GGAGGTGCCGATCCAGAAATTGG - Intergenic
910408552 1:86915210-86915232 GGCGCTGCCGCCGGAGCAAGTGG + Intronic
915142354 1:153775470-153775492 GACGGTGCCGATAGAGGAAGCGG + Exonic
915325900 1:155080988-155081010 GGCGGGGCCGACCGAGCCACAGG + Intronic
1066114556 10:32227989-32228011 GGTGGTGCCCACCCAGATAGAGG + Intergenic
1077188649 11:1246602-1246624 GGCGGTGCCCAGGGAGGAAGAGG - Exonic
1079128535 11:17734956-17734978 GGCGCTGCCGGCCGAGACGGGGG - Exonic
1097051256 12:56224560-56224582 GGCGGAGCCGACGTAGACAGGGG - Exonic
1104548074 12:129730689-129730711 GATGGTGCCCACCGAGAATGAGG - Intronic
1107133469 13:36920157-36920179 GGCGGCGGGGACCGAGACAGCGG + Exonic
1117776496 14:59189231-59189253 GGCGGTGGCGACAGGGAAGGAGG + Intronic
1120214516 14:81668022-81668044 GGCGGTGCAGACCCAAAGAGTGG + Intergenic
1122743600 14:103885595-103885617 GGTGGTGCTGACCTCGAAAGTGG + Intergenic
1127326162 15:57897087-57897109 GGCGGTGCCCACCCAGACTGAGG + Intergenic
1136454015 16:30370252-30370274 GGCGAGGCCAGCCGAGAAAGGGG + Exonic
1141593344 16:85082896-85082918 GGCGGTGACGCCGGGGAAAGCGG + Intronic
1142136155 16:88452955-88452977 GGCGGGGCCGAACCAGGAAGGGG + Intergenic
1142899602 17:3003961-3003983 GTCTGTGCCGACCGTGTAAGTGG - Intronic
1144668591 17:17118613-17118635 GGCGGTGACGACTGGGAAGGGGG + Intronic
1150612833 17:66747919-66747941 GGGGGTGCCGGGCCAGAAAGAGG + Intronic
1154416521 18:14178496-14178518 GGCAGTGCCGTCCCAGATAGCGG - Intergenic
1167358719 19:49018845-49018867 GGCGGTGCCGAGCGAGAGCCCGG + Intergenic
1167366412 19:49057093-49057115 GGCGGTGCCGAGCGAGAGCCCGG + Intronic
930872848 2:56185008-56185030 GGGGGTGCCGACCGGGAGAAGGG - Intronic
932323171 2:70836828-70836850 GGAGGTGCGGACAGAGAGAGAGG - Intergenic
934557240 2:95293945-95293967 GGAGGAGCCCACAGAGAAAGAGG + Intergenic
937134870 2:119544161-119544183 GGCGGAGCCGCCCGAGCCAGTGG - Intergenic
937988748 2:127650593-127650615 GGCGGTGCTGAGCTTGAAAGTGG + Intronic
942455663 2:176136718-176136740 GGCGATGCGGACCGAGTGAGCGG - Intergenic
1172568974 20:35954218-35954240 GGCGGTGCCACCGGAGAAACTGG - Exonic
1173595949 20:44258420-44258442 GGCGGTGCCCACAGAGCACGTGG + Exonic
1179561609 21:42219279-42219301 GGCGGTGCCGACCGAGAAAGCGG - Exonic
1181902752 22:26169579-26169601 GGCGGCGGTGAGCGAGAAAGGGG - Exonic
1184881040 22:47304357-47304379 GGCGGTGCCTTCTGAGACAGAGG + Intergenic
953271494 3:41449425-41449447 GGCGGTGGCTACTCAGAAAGAGG + Intronic
957123962 3:76133816-76133838 GGCGGTGCCCACCCAGATCGAGG + Intronic
960989027 3:123298604-123298626 GGTGGTGTCGCCTGAGAAAGTGG - Intronic
972546249 4:40083109-40083131 GGCGGTGCAGACATAGAAAAAGG + Intronic
974742567 4:66025062-66025084 GGGGGTGCGGGCCGAGAAAAGGG + Intergenic
986586359 5:9322140-9322162 GGAGGTGTGGACTGAGAAAGTGG - Intronic
987303463 5:16617135-16617157 GGGGGAGCCGCCCGGGAAAGTGG + Intergenic
1002236597 5:177807859-177807881 GGCGGTGGTGACAGAGACAGCGG + Intergenic
1003107577 6:3227838-3227860 GGGCGTGCCGACCGGGAGAGGGG + Intronic
1022113038 7:27243135-27243157 GCCGGAGCCGCCCGAGAAAATGG + Exonic
1023374625 7:39543661-39543683 GGTGGTGCTGAGCGAGTAAGGGG + Intergenic
1024268500 7:47624749-47624771 GGTGGTGCAGAGTGAGAAAGTGG + Intergenic
1031381164 7:121087590-121087612 GGCTGTGCAGACCCAGATAGTGG - Intronic
1038484196 8:27921988-27922010 GGCGGTGCAGACCGAGCAGGCGG - Exonic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1057311485 9:93945905-93945927 GGCGGCGCCGCCCGTGCAAGGGG - Intergenic
1059769891 9:117414981-117415003 GGCGGTGGCGAAGGAGGAAGAGG + Exonic