ID: 1179561614

View in Genome Browser
Species Human (GRCh38)
Location 21:42219311-42219333
Sequence GAGCGCATCCTTCGTCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179561606_1179561614 21 Left 1179561606 21:42219267-42219289 CCTGTCTGATGGCCGCTTTCTCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1179561614 21:42219311-42219333 GAGCGCATCCTTCGTCCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1179561611_1179561614 -9 Left 1179561611 21:42219297-42219319 CCGCCATGGTGAGTGAGCGCATC 0: 1
1: 0
2: 2
3: 9
4: 74
Right 1179561614 21:42219311-42219333 GAGCGCATCCTTCGTCCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 23
1179561609_1179561614 9 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561614 21:42219311-42219333 GAGCGCATCCTTCGTCCGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179561614 Original CRISPR GAGCGCATCCTTCGTCCGCC GGG Intronic