ID: 1179561619

View in Genome Browser
Species Human (GRCh38)
Location 21:42219330-42219352
Sequence CGGGAACGGTTTTATTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179561612_1179561619 7 Left 1179561612 21:42219300-42219322 CCATGGTGAGTGAGCGCATCCTT 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1179561619 21:42219330-42219352 CGGGAACGGTTTTATTTTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 75
1179561611_1179561619 10 Left 1179561611 21:42219297-42219319 CCGCCATGGTGAGTGAGCGCATC 0: 1
1: 0
2: 2
3: 9
4: 74
Right 1179561619 21:42219330-42219352 CGGGAACGGTTTTATTTTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 75
1179561609_1179561619 28 Left 1179561609 21:42219279-42219301 CCGCTTTCTCGGTCGGCACCGCC 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1179561619 21:42219330-42219352 CGGGAACGGTTTTATTTTCAAGG 0: 1
1: 0
2: 0
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179561619 Original CRISPR CGGGAACGGTTTTATTTTCA AGG Intronic