ID: 1179562114

View in Genome Browser
Species Human (GRCh38)
Location 21:42222084-42222106
Sequence TATGTGGCCCGGTGCGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179562114 Original CRISPR TATGTGGCCCGGTGCGGGGG TGG Intronic
900425883 1:2578423-2578445 CATGTGGGCGGGTGTGGGGGAGG - Intergenic
900710156 1:4108464-4108486 CATGTGCCCCGGGGCGGGGGCGG + Intergenic
907245502 1:53105947-53105969 TATGTGGCACAGTCTGGGGGCGG - Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
911261698 1:95693994-95694016 TGTGTGGCGGGGTGAGGGGGAGG + Intergenic
914428560 1:147600065-147600087 TTCGTGGCGCGGTGCGGCGGGGG + Intronic
918183832 1:182109930-182109952 TGTGTGGCGGGGAGCGGGGGCGG + Intergenic
919777615 1:201204542-201204564 TATGTGCCCCAGCACGGGGGAGG + Intronic
923524052 1:234758766-234758788 TATGCTGTCTGGTGCGGGGGGGG + Intergenic
923592163 1:235328488-235328510 TGCGTGGACCGGTGCGGGGGCGG + Intronic
923854680 1:237833356-237833378 TATGGGGGCGGGGGCGGGGGGGG - Exonic
924374420 1:243390493-243390515 AGTGTGGCCCGGGGCGGGAGAGG + Intronic
924445350 1:244124720-244124742 GATGGGGCCCAGTGCTGGGGTGG + Intergenic
1064193214 10:13225382-13225404 TAGGTGACTCGGGGCGGGGGCGG + Intronic
1065140329 10:22713950-22713972 TCTATGGCCCGGTGCGGGTCGGG - Intronic
1066704393 10:38162045-38162067 GATGTGGCCAGGTGCCGTGGCGG - Intergenic
1067934538 10:50598075-50598097 TTTGTGGGGCGGGGCGGGGGAGG - Intronic
1069833642 10:71295732-71295754 TCTGTGGCACTGTGCGGGGCAGG - Intronic
1073207419 10:101776277-101776299 GATGCAGCCCGGGGCGGGGGCGG + Intronic
1075711023 10:124530574-124530596 TGTGTGGCCTGGGGCGTGGGGGG - Intronic
1076829908 10:132988984-132989006 CCTGAGGCCCGGTGGGGGGGGGG + Intergenic
1077183269 11:1225739-1225761 TATGTGGCCAGGTTCGGGGGTGG + Intronic
1083428392 11:62601380-62601402 TACGGGGCCCGGGGCGGGAGAGG - Intronic
1083617541 11:64034069-64034091 TCTGTGGCTTGGTGTGGGGGTGG + Intronic
1084643785 11:70442460-70442482 TCTGTTGCCCAGTGCGGTGGCGG - Intergenic
1088587838 11:111375681-111375703 TATCAGGCCGGGTGCGGTGGCGG - Intronic
1089123818 11:116162213-116162235 TCTGTGGCTGGGAGCGGGGGTGG + Intergenic
1091284657 11:134401956-134401978 GGTGTGGCCTGGGGCGGGGGGGG + Intronic
1096570462 12:52520175-52520197 TCCGTGTCCCGGTCCGGGGGTGG - Exonic
1101731595 12:107431616-107431638 TTTGGGGGCGGGTGCGGGGGCGG - Intronic
1103551944 12:121744354-121744376 TCTGTGGCCCTGGGCGGTGGAGG + Intronic
1109769862 13:66956462-66956484 AATTTGGCCAGGTGCGGTGGTGG + Intronic
1110009283 13:70311500-70311522 TATATGGCCAGGGGTGGGGGTGG - Intergenic
1115194083 14:30777615-30777637 TATGCGGGCTGGTGCGGGGCGGG - Intergenic
1115689219 14:35826370-35826392 TGTGAGGCCCGGGCCGGGGGCGG + Exonic
1116866481 14:50035821-50035843 AATTTGGCCGGGTGCGGTGGCGG - Intergenic
1117351228 14:54883817-54883839 TATGAGGCCTGGGGCAGGGGTGG + Intronic
1119281733 14:73414707-73414729 TCTGGGGGCGGGTGCGGGGGGGG + Intronic
1121237586 14:92403830-92403852 TATGTGCCAGGGTGGGGGGGAGG - Intronic
1121410364 14:93745006-93745028 CCTGTAGCCCGGGGCGGGGGTGG + Intronic
1121664832 14:95664593-95664615 TATGAGGCCTGGTGCTGTGGGGG - Intergenic
1127426356 15:58862772-58862794 TTTCTGGCCAGGTGCGGTGGTGG + Intergenic
1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG + Exonic
1131111471 15:89767490-89767512 ACAGTGGCCCGGTGGGGGGGAGG + Intronic
1131462098 15:92624716-92624738 GATGTGGCCCCGTGGGGGTGTGG - Intronic
1133454452 16:5930527-5930549 TATGTGGGCGGGTGGGAGGGTGG + Intergenic
1136239582 16:28936074-28936096 TGTGGGGCCAGGTGCTGGGGAGG - Intronic
1138010427 16:53373801-53373823 TATGTGGGCCGGAGAGGCGGGGG + Intergenic
1141669959 16:85486491-85486513 TAGGTGGCTCCGTTCGGGGGTGG + Intergenic
1141692231 16:85602858-85602880 TGTGTGGGCCCCTGCGGGGGAGG - Intergenic
1142426252 16:90003673-90003695 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142426304 16:90003838-90003860 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142426322 16:90003893-90003915 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142426340 16:90003948-90003970 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142426375 16:90004058-90004080 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1144964896 17:19070670-19070692 TATGGGGACCGGTGCGTGGGTGG - Intergenic
1144983071 17:19181508-19181530 TATGGGGACCGGTGCGTGGGTGG + Intergenic
1144985154 17:19196731-19196753 TATGGGTACCGGTGCGTGGGTGG - Intergenic
1147176264 17:38657970-38657992 CATGGGGCACGGGGCGGGGGGGG + Intergenic
1148645447 17:49217579-49217601 TATGTAGCCTGGTGGGGGGCGGG + Intronic
1149561051 17:57608232-57608254 TATGTGGCCAGGTGAGGGCAAGG - Intronic
1151554614 17:74840432-74840454 TTTGTGGCCGGGGGGGGGGGGGG - Intergenic
1154167424 18:12026654-12026676 TTTGTGGCCAGGTGAGGGTGGGG + Intronic
1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG + Intronic
1159040323 18:63318520-63318542 GAAGATGCCCGGTGCGGGGGCGG + Exonic
1161153531 19:2721280-2721302 TAGGCGGCCCGGGGCGGGGAGGG - Intronic
1162954590 19:14091013-14091035 GAGTTGGCCCGGGGCGGGGGCGG + Intronic
1165068371 19:33241601-33241623 TCTGTGGCCGTGTGCGTGGGAGG + Intergenic
1166583118 19:43920523-43920545 GATGTTGCCGGGTGGGGGGGGGG + Intronic
925190775 2:1881674-1881696 GATGTGGCACAGTGCTGGGGAGG + Intronic
925730551 2:6917359-6917381 TGTGCGGCTCGGCGCGGGGGCGG + Intergenic
928682182 2:33713988-33714010 AATGGGGCCTGTTGCGGGGGTGG + Intergenic
933994245 2:87656188-87656210 TCTGTGCCCAGGTGCGGGGGAGG - Intergenic
935757335 2:106286510-106286532 TGTGTGGCCAGGGCCGGGGGTGG + Intergenic
936299617 2:111294725-111294747 TCTGTGCCCAGGTGCGGGGGAGG + Intergenic
937991388 2:127664282-127664304 TAGGTGGCCAGGGGCGGGGCGGG - Intronic
938349534 2:130589159-130589181 CATGTGGCCCTGTGTGGGGTGGG - Intergenic
938855150 2:135301895-135301917 TATGTGGCAAGGTGCTAGGGAGG - Intronic
942738548 2:179146008-179146030 TCTGTGGCCCAGGGTGGGGGTGG - Intronic
945802567 2:214451294-214451316 TAAGTGGGTCGGTGTGGGGGGGG + Intronic
947618525 2:231574098-231574120 TCTTTGGGGCGGTGCGGGGGTGG - Intergenic
948212980 2:236208618-236208640 TCTGTGACCCGGTGGGGGAGGGG - Intronic
1173914758 20:46698714-46698736 TGTGAGGCCGGGTGCGGTGGTGG - Intergenic
1175067810 20:56304953-56304975 TTTGGGGCCCGGTGCTGGGAGGG - Intergenic
1176100214 20:63361300-63361322 TGTGGGGCGCGGTGCGGCGGCGG + Exonic
1176150327 20:63587502-63587524 TGAGTGGTCCGGGGCGGGGGTGG + Intergenic
1179425110 21:41270567-41270589 TTTGTGGCCAGGTGTGGTGGTGG - Intronic
1179506377 21:41844605-41844627 TGTGTGTCCCTGTGAGGGGGAGG - Intronic
1179506454 21:41844890-41844912 TGTGTGTCCCTGTGAGGGGGAGG - Intronic
1179506511 21:41845057-41845079 TGTGTGTCCCTGTGAGGGGGAGG - Intronic
1179506591 21:41845289-41845311 TGTGTGTCCCTGTGAGGGGGAGG - Intronic
1179506600 21:41845315-41845337 TGTGTGTCCCTGTGAGGGGGAGG - Intronic
1179562114 21:42222084-42222106 TATGTGGCCCGGTGCGGGGGTGG + Intronic
1179876516 21:44271701-44271723 AATGTGGCCTGGTTCGGGGCTGG - Intergenic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181286441 22:21755687-21755709 AATTTGGCCCGGTGTGGTGGCGG - Exonic
1184449890 22:44576579-44576601 TGTGTGGCCAGGTGTGTGGGAGG + Intergenic
1185342832 22:50299304-50299326 GGGGGGGCCCGGTGCGGGGGCGG + Intronic
949753641 3:7383652-7383674 TAAGTGGACTGTTGCGGGGGTGG - Intronic
950265300 3:11568883-11568905 GATGAGGCCCGGGGCGGGGCCGG - Intronic
950339501 3:12230109-12230131 TTTGCGGCCCGGTGCGGGCAAGG + Intergenic
954397293 3:50299509-50299531 TATGGGGCCGGGTGGGGAGGAGG - Intergenic
961661315 3:128470116-128470138 CATGTGGCTGGGTGGGGGGGTGG - Intergenic
972487517 4:39556363-39556385 TATGTGGCCTGGGGCAGGGAAGG - Intronic
975602605 4:76118561-76118583 TTTGTGGCGGGGTGGGGGGGGGG + Intronic
980979994 4:139646608-139646630 AATATGGCCAGGTGCGGTGGTGG - Intergenic
981000510 4:139824841-139824863 TATATGGGCTGGGGCGGGGGTGG - Intronic
981867163 4:149436810-149436832 TATGTGGCCTGGTGAGGTAGGGG - Intergenic
985672303 5:1213153-1213175 TATGTGGGATGGTGCGGAGGGGG - Intronic
986451420 5:7869280-7869302 GAGGCGGCCCGGGGCGGGGGTGG + Intronic
986748090 5:10761378-10761400 GCTGTGGCCGGGGGCGGGGGCGG + Intergenic
987766692 5:22240819-22240841 TATCCGGCCAGGTGCGGCGGTGG - Intronic
992880642 5:81105801-81105823 TATGTGGCGGGGTCAGGGGGTGG - Intronic
995185743 5:109268094-109268116 TATCTGACCTGGTGCTGGGGTGG - Intergenic
1002495105 5:179606413-179606435 CAGGTGGCCCGGTGTGGGTGCGG + Intronic
1007204611 6:40138610-40138632 TATGTGACTAGGTGTGGGGGTGG - Intergenic
1007210177 6:40187391-40187413 TGTGTGGCGGGGTGAGGGGGTGG + Intergenic
1007479835 6:42142568-42142590 CCTGTTGCCCGGTGCGCGGGCGG - Intronic
1007557706 6:42781025-42781047 TATGTGGCCCAGGCCGGGCGCGG - Intronic
1013179556 6:107706681-107706703 TATGGGGCCAGGTGGGTGGGGGG + Intronic
1013465962 6:110417337-110417359 TCTGAGGGCCGGTGAGGGGGTGG + Intergenic
1014116891 6:117676085-117676107 GGTGAGGCCCGGTGCGGTGGTGG + Exonic
1015976475 6:138796156-138796178 TATGAGGCCCGGTACAGTGGCGG - Exonic
1017880539 6:158559958-158559980 TTCGTGGCCCCGTGCCGGGGCGG - Intronic
1019659829 7:2218117-2218139 TATGTGGGTCTGTGCTGGGGCGG - Intronic
1019702336 7:2480069-2480091 GATGTGGCCGGGGGCGGGGAGGG - Intergenic
1019739636 7:2666173-2666195 TATGTGGGCGGGGGGGGGGGGGG + Intergenic
1020137727 7:5596016-5596038 GATGTGGGACGGCGCGGGGGTGG + Intronic
1021078250 7:16331370-16331392 AATGTGGCAAGGTGTGGGGGCGG - Intronic
1022499956 7:30876584-30876606 AATGTGGCCAGGTGCTGAGGGGG + Intronic
1023259273 7:38341813-38341835 TGTGTGGCGGGGGGCGGGGGGGG + Intergenic
1025603602 7:63023051-63023073 TATGTGGCGGGGTGTGGAGGTGG + Intergenic
1027647061 7:80814929-80814951 TTTGTGGCACGGTGCGTGGGGGG - Intronic
1031407651 7:121405660-121405682 TATGTGGGGCGGTGGGTGGGGGG + Intergenic
1031964052 7:128014626-128014648 TATGTGGGCCTGTGGGTGGGTGG - Intronic
1033223714 7:139544853-139544875 TCTGGGGCCCGGGGCGGGGCTGG - Exonic
1035126012 7:156607987-156608009 TCTGCAGCCCGGTGCGCGGGGGG - Intergenic
1035313377 7:157983569-157983591 CATGTGGGCGGGGGCGGGGGAGG - Intronic
1037925529 8:22841255-22841277 TCTGTGGCCCTTTGAGGGGGTGG + Intronic
1040042883 8:42934548-42934570 ACTGGGGCCTGGTGCGGGGGAGG - Intronic
1040275660 8:46012442-46012464 TGTGTGGCCCGGGTTGGGGGGGG - Intergenic
1045042605 8:98240826-98240848 TAGGTGGCCGGGTGCTGGGCTGG + Intronic
1047237875 8:123058290-123058312 TATTTGGCCTTGTGAGGGGGAGG - Intronic
1050297751 9:4223217-4223239 TATGTGGCAATGTGCTGGGGTGG - Intronic
1056243148 9:84669121-84669143 TAGGTGGCCCGGAATGGGGGCGG + Intronic
1057995787 9:99820998-99821020 TTTCTGACCCGGTGCCGGGGAGG + Intergenic
1058039670 9:100290092-100290114 TTTTTGGCCCGGTGGGGTGGGGG + Intronic
1058893549 9:109381361-109381383 TAGGTGGGTCGGTGCGGGGGAGG + Intronic
1059179744 9:112200617-112200639 TATATGGCCAGCTGCAGGGGAGG - Intergenic
1059230674 9:112718301-112718323 GGCGTGGCCCGGGGCGGGGGAGG + Intergenic
1060177868 9:121510777-121510799 TATGGGGCCTGGCGCGGGTGCGG - Intergenic
1061261460 9:129482873-129482895 AATGAGGCCCGGGGCGGGCGGGG + Intergenic
1185480198 X:440455-440477 TATGTGCACCTGTGTGGGGGGGG - Intergenic
1185592847 X:1289109-1289131 GATGTGGCCTGGTGTGGTGGCGG - Intronic
1189352097 X:40283401-40283423 TATGTGGCGGGGCGGGGGGGTGG - Intergenic
1192603028 X:72485053-72485075 TGTGTGGCCCGGGGATGGGGTGG + Intronic
1194553483 X:95330322-95330344 TTTGTGGCCTGGTGTGGAGGTGG - Intergenic