ID: 1179563989

View in Genome Browser
Species Human (GRCh38)
Location 21:42235019-42235041
Sequence CAGCCTCCCTGGGACAGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179563973_1179563989 28 Left 1179563973 21:42234968-42234990 CCCGCGCTGTTGCCAAGCGCGAG No data
Right 1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG No data
1179563972_1179563989 29 Left 1179563972 21:42234967-42234989 CCCCGCGCTGTTGCCAAGCGCGA No data
Right 1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG No data
1179563981_1179563989 -8 Left 1179563981 21:42235004-42235026 CCCCGAGCGGGGTCGCAGCCTCC No data
Right 1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG No data
1179563982_1179563989 -9 Left 1179563982 21:42235005-42235027 CCCGAGCGGGGTCGCAGCCTCCC No data
Right 1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG No data
1179563983_1179563989 -10 Left 1179563983 21:42235006-42235028 CCGAGCGGGGTCGCAGCCTCCCT No data
Right 1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG No data
1179563974_1179563989 27 Left 1179563974 21:42234969-42234991 CCGCGCTGTTGCCAAGCGCGAGG No data
Right 1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG No data
1179563977_1179563989 16 Left 1179563977 21:42234980-42235002 CCAAGCGCGAGGAGGCAGCTGCA No data
Right 1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179563989 Original CRISPR CAGCCTCCCTGGGACAGGGG CGG Intronic