ID: 1179565857

View in Genome Browser
Species Human (GRCh38)
Location 21:42248328-42248350
Sequence GTCCAGACAGCAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179565857 Original CRISPR GTCCAGACAGCAGTGGTGGA GGG Intronic
901018671 1:6245301-6245323 GCCCAGACGGCAGGGGTGCAAGG - Exonic
902139562 1:14341496-14341518 GGCCAGACAGAAGTGAAGGAAGG - Intergenic
902699754 1:18163684-18163706 GTGCAGCCAGCATTGGTGGGTGG + Intronic
903168885 1:21540099-21540121 GTACAGAAAGCGGTGGGGGAGGG - Intronic
903365961 1:22805565-22805587 GTCCAGACAGCTGGGCTGGAGGG + Intronic
903562379 1:24237435-24237457 GTGGGGACAGCAGTGTTGGATGG + Intergenic
905031769 1:34888976-34888998 GTCCAGACACCAGGGATGAAAGG + Intronic
907280525 1:53344205-53344227 GTTCAGACTGCAGGGCTGGAAGG + Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
911029734 1:93473772-93473794 GTGGAGCCAGCAGTGGTGGATGG + Intronic
912025225 1:105161572-105161594 ATCCAGAGAGAAGTGGTGGATGG - Intergenic
912391778 1:109307838-109307860 GGAGAGGCAGCAGTGGTGGAGGG + Intergenic
913478354 1:119260710-119260732 TTCCAGATGGCAGTGATGGATGG - Intergenic
916349216 1:163829911-163829933 GTGCAGACAGCAGTTGTGCCAGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917625259 1:176839547-176839569 GTCCAGCCCGCAGTGGTGCTCGG - Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919939466 1:202276365-202276387 GTCCAGCCAGAGGTGGCGGAGGG - Exonic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921420599 1:214943427-214943449 GTTGAGTCAACAGTGGTGGATGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923304596 1:232676489-232676511 CTCCAGAAAGCATTGGTTGATGG + Intergenic
1062817113 10:508876-508898 GTTCCAACAGCAGTGCTGGAAGG + Intronic
1063199458 10:3774064-3774086 GGCGAGACAGCAGTGTGGGATGG + Intergenic
1063652977 10:7958625-7958647 GTGGAGAAAGCAGGGGTGGATGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066294594 10:34043211-34043233 GTCCAGGCAGCAGTCATGGGCGG - Intergenic
1066435991 10:35397104-35397126 GTCCACAGAGCAGTGGCAGAGGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069555403 10:69394536-69394558 GTCACTACAGCAGTGGTGGTGGG + Intronic
1069731604 10:70619388-70619410 GTCCAGACAAAACTGGAGGAAGG + Intergenic
1069967775 10:72135684-72135706 GGACAGACAGCAGTGGAGGCAGG + Intronic
1070583391 10:77742037-77742059 GGCCACTCAGCAGTGGTGGTAGG + Intergenic
1070656766 10:78276954-78276976 GTTCAGACAGCAGTGGCTGAGGG - Intergenic
1070663551 10:78327858-78327880 GTGGTGGCAGCAGTGGTGGAGGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072053270 10:91727737-91727759 ATCAAGGCAGTAGTGGTGGAGGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072415619 10:95244503-95244525 GTTCAGAAAGCAGTGCTGCAGGG - Intronic
1072428981 10:95354630-95354652 GTCCAGCCAGCACTGCTGCATGG - Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072600941 10:96928548-96928570 TTCAAGACATCAGTGGAGGAAGG - Intronic
1073811895 10:107161399-107161421 GGCCAGATTGGAGTGGTGGAGGG - Intronic
1073891981 10:108112693-108112715 GTCCAGATAATAGTGGTGGTGGG + Intergenic
1076261371 10:129069786-129069808 GTCCAGACACTTGTGGTTGAGGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1078740087 11:14058471-14058493 GTCCAGACAGCAGTGGCAAAAGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081614616 11:44583269-44583291 GTCCAGGCAGGAATGCTGGAGGG + Intronic
1081780146 11:45704767-45704789 GTACAGTCAGGAGTGGTAGATGG - Intergenic
1083372374 11:62192524-62192546 GTCCAGGCAGGGGTGGTGAAGGG + Intronic
1084263277 11:67991993-67992015 GTCCAGGAAGCATGGGTGGAGGG - Intronic
1084442652 11:69183798-69183820 GGCCACAGAGCAGTGCTGGAGGG + Intergenic
1084444065 11:69193284-69193306 GTCCAGACAGGGGTGGTAGCAGG + Intergenic
1084618271 11:70251109-70251131 GTCCAGCCAGCACAGGAGGAAGG + Intergenic
1084741055 11:71139917-71139939 GCCCGGACAGCAGCGGAGGAGGG + Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085835948 11:79956551-79956573 GTACAGAAAACAGTAGTGGAGGG + Intergenic
1086050614 11:82585497-82585519 GTACAGACACCAGTGAAGGATGG + Intergenic
1087081311 11:94173597-94173619 GTCCACACAGAAGAGGGGGACGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088866287 11:113851143-113851165 GGCCAGGCTGCTGTGGTGGAGGG - Intronic
1088879942 11:113965209-113965231 GTCCAGGCAGCAGTGGGACAAGG + Intergenic
1089314312 11:117580754-117580776 ATCCACACAGCAGTGCTAGAAGG - Intronic
1089496038 11:118909183-118909205 GTCCAGACAGCTGGAGGGGAAGG + Intronic
1089642534 11:119857163-119857185 TGCCAGGCAGCAGAGGTGGAAGG + Intergenic
1090239929 11:125174810-125174832 GCCCAAATAGCGGTGGTGGAAGG + Intronic
1090379733 11:126318047-126318069 GTCCAGAAAGCAGAGGGGGTAGG - Intronic
1090404387 11:126468182-126468204 GTCCACACAGCAGGGGAGGAAGG - Intronic
1091716020 12:2776681-2776703 GTCCTCACAGCAGTCCTGGAAGG - Intergenic
1092279558 12:7089243-7089265 GTGCAGACAGAAGGGGAGGAAGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093561783 12:20551645-20551667 GTCCAGGCAGTAGATGTGGAAGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097393260 12:59041413-59041435 GCCCAGACAACAGTGTTTGATGG + Intergenic
1098146636 12:67504214-67504236 GTCAAAACAACAGTGGAGGAGGG + Intergenic
1098280173 12:68854699-68854721 GTCCACACAGCACTGGGGAAGGG - Exonic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099292613 12:80790072-80790094 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1100460609 12:94795660-94795682 CTCCAGCCTGCTGTGGTGGATGG - Intergenic
1101268738 12:103119992-103120014 GTCCACACAGCACTGGAGGCTGG + Intergenic
1103322558 12:120100515-120100537 TCCCAGACAGAGGTGGTGGAAGG + Intronic
1104188696 12:126457572-126457594 GCCCAGGCACCAGTGCTGGAGGG - Intergenic
1104665620 12:130645495-130645517 GTCCTGACTGTAGGGGTGGAAGG - Intronic
1106235635 13:27858091-27858113 GTACACACAGCCGGGGTGGATGG - Intergenic
1107291912 13:38864152-38864174 TGCCATACAGCAGTGGTGTATGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110125264 13:71934262-71934284 GGCCAAACAGTAGTGGTGGGAGG + Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111038032 13:82704957-82704979 GTGCAGAGATAAGTGGTGGAGGG + Intergenic
1111118191 13:83809634-83809656 CTCCAGATAGCATTGCTGGAGGG + Intergenic
1111663666 13:91241781-91241803 GTAAAGACAGCAAAGGTGGAGGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113431735 13:110256384-110256406 GTGAAGACAGCAGAGGAGGATGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118003773 14:61547102-61547124 TTCGAAACAGCAGTGGTGGGGGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119266363 14:73265138-73265160 GTCTGGCCAGCTGTGGTGGAGGG + Intronic
1119653347 14:76399104-76399126 GTCCAAACAGCAGATGTGGATGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121206379 14:92171962-92171984 GTCCTCACAGCAGTGATGTACGG - Exonic
1122355105 14:101118235-101118257 GTCCAGGCTCCAGTGGGGGATGG - Intergenic
1122536204 14:102464964-102464986 GTCCACACAGCCGATGTGGATGG + Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1124577437 15:30922281-30922303 GTCCTGACAGCAGAGGCCGATGG + Exonic
1124630382 15:31333345-31333367 GTCCAGACAGGAGTGGCAGTAGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128231605 15:66039330-66039352 GTCCTGACAGCTGAGGAGGAGGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128393589 15:67200495-67200517 GTCCATACATAAGTGCTGGAAGG - Intergenic
1128892366 15:71342677-71342699 CTCCAGGCAGCCGTGTTGGAGGG + Intronic
1129452951 15:75660985-75661007 GCCCAGGGAGCAGTGGTGGCTGG + Exonic
1129615563 15:77096777-77096799 GTCCCAATAGCAGTGGTGGGTGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130539362 15:84811156-84811178 GTCTAGACAACCCTGGTGGAGGG - Intergenic
1130822161 15:87507256-87507278 GGCCTCACAGTAGTGGTGGAAGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132025618 15:98402280-98402302 GTCCTGATAGCAGGGGTGGGAGG - Intergenic
1132383098 15:101380179-101380201 GTCTAGACAGCACAGGTTGAGGG - Intronic
1133245382 16:4445335-4445357 GTACAGACAGCAGGGATGGAAGG + Intronic
1133841764 16:9416524-9416546 CTCCAGAAAGGATTGGTGGAAGG + Intergenic
1134524335 16:14932649-14932671 GTCCAGACTGTTGCGGTGGAAGG - Intronic
1134711924 16:16331136-16331158 GTCCAGACTGTTGCGGTGGAAGG - Intergenic
1134719780 16:16374429-16374451 GTCCAGACTGTTGCGGTGGAAGG - Intergenic
1134947646 16:18337456-18337478 GTCCAGACTGTTGCGGTGGAAGG + Intergenic
1134954904 16:18377558-18377580 GTCCAGACTGTTGCGGTGGAAGG + Intergenic
1135524960 16:23207212-23207234 GTGCAGCCAGCAGGGGTGGCTGG - Intronic
1135718600 16:24794944-24794966 TCCCAGGCAGCACTGGTGGAGGG - Intronic
1135920627 16:26645908-26645930 GTCCAGGCAGCAGCGGGAGAAGG + Intergenic
1136105489 16:28027079-28027101 GGACACACAGCAGTGGTGGAGGG + Intronic
1139558138 16:67725606-67725628 GGCCACACAGCAGAGGTAGAGGG - Exonic
1140549005 16:75843474-75843496 TTCAAGACATCAGTGGAGGAAGG - Intergenic
1141859694 16:86708160-86708182 GTCCAGAAAGCAGGGATGGCTGG - Intergenic
1143783023 17:9239403-9239425 GTCCCGACGGCAGTGCTGGGTGG + Intronic
1146820943 17:35983231-35983253 TTCCAGACAGCAGTGAAGAAAGG + Intergenic
1147987457 17:44314833-44314855 TGCCTGACGGCAGTGGTGGAGGG + Intronic
1148752526 17:49953525-49953547 GTGGAGACAGCTGTCGTGGATGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149776886 17:59365325-59365347 CCCCAGAAAGCTGTGGTGGAAGG - Intronic
1150475921 17:65474877-65474899 GTCCAATCAGCTGAGGTGGAAGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151946224 17:77321370-77321392 GCCCTGGGAGCAGTGGTGGAGGG - Intronic
1151965406 17:77428676-77428698 CTACAGAGAGCAGTGCTGGATGG + Intronic
1152724989 17:81940781-81940803 GGCCAGAGAGCAGAGGTGGGTGG + Exonic
1153274118 18:3351329-3351351 GTTCAGACAGTTGGGGTGGAAGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153534890 18:6090909-6090931 GTCCAGAGCTCAATGGTGGATGG + Intronic
1154106214 18:11525717-11525739 GTGCAGAGAGTAGTGATGGATGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158105106 18:53876484-53876506 TTCCAGACAGCAATGTTGGTGGG + Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158470799 18:57735192-57735214 AGCAAAACAGCAGTGGTGGACGG - Intronic
1160490615 18:79334566-79334588 GTCCACACAGCAGAGGGGGGTGG + Intronic
1160877779 19:1305170-1305192 GTCCAAACAGCCATGATGGAGGG + Intergenic
1161067056 19:2243827-2243849 GTCCAGCCAGATGTGGTGAAGGG + Intronic
1161555787 19:4941874-4941896 GTCCAGGCAGTAGATGTGGAAGG - Exonic
1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG + Intergenic
1163551695 19:17969128-17969150 GCCCAGATTGCAGTGGGGGAGGG + Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164284330 19:23799574-23799596 GTCCATACCGCAGTGGCAGATGG + Intronic
1165772002 19:38385573-38385595 TGCCTGACAGCAGTGGTGGAGGG - Exonic
1167169527 19:47821937-47821959 GGCCAGACAGCAGAGGCTGAAGG - Exonic
1167461388 19:49626243-49626265 ATCCAGACAACAATGGGGGATGG - Exonic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925452516 2:3981784-3981806 GTCAAAACAGCTGTGGTGGGTGG - Intergenic
926192351 2:10738372-10738394 GTCCAGCCAGCAGGGGAGGAAGG + Intronic
926864982 2:17346308-17346330 GGCAAAACAGCAGTGGTAGATGG - Intergenic
927421938 2:22943032-22943054 GTCTACTCAGCAGTGGTGAATGG - Intergenic
928923624 2:36553597-36553619 GTCAAGGCAGCAGTGGCGGCAGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930051621 2:47220332-47220354 CTCCCCACAGCAGTGCTGGAGGG + Intergenic
930566042 2:53021953-53021975 GTAAAGACAGCATAGGTGGAGGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931627688 2:64271626-64271648 GATCAGACAGGAGTGGTAGAAGG + Intergenic
932115452 2:69042711-69042733 GGCCAGACAGCAGTGGGTTAAGG - Intronic
932361508 2:71111783-71111805 TTCCAGACTGCAGTGCAGGAAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934757395 2:96833497-96833519 GTGCAGAGAGCAGTGAGGGAGGG + Exonic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
937221960 2:120346871-120346893 TTCCGGAGAGCAGGGGTGGAGGG - Intronic
937857804 2:126685294-126685316 AGCCAGACAGCAATGGGGGAAGG - Intronic
938794427 2:134706068-134706090 TTCCAGCCAGGAGTGGGGGAGGG - Intronic
938990587 2:136624377-136624399 GGCCAGTCAGTAGTGGTGGGAGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940979679 2:159987192-159987214 GTCCAAATAGCAGGGGTGAAAGG + Exonic
942040086 2:172052313-172052335 ATCCAGGAAGCAGTGGTGTATGG + Intronic
942298067 2:174536463-174536485 GTGCAGCCAGCAGTGGGGGATGG + Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
946295708 2:218782107-218782129 GCCCAGACAGCAGTGCAGGGCGG - Exonic
946381599 2:219352656-219352678 GGCCAGTCAGCAGTTCTGGATGG - Intergenic
947534617 2:230933103-230933125 GACCAGAAGGCAGTGATGGAGGG - Intronic
947930436 2:233960322-233960344 GTAGAGACAGCACTGGTGGCTGG + Intronic
948570997 2:238916999-238917021 GTCCACACACCGGGGGTGGAAGG - Intergenic
1169211484 20:3768249-3768271 GTCGAAACAGGAGTGATGGAGGG - Intronic
1171033852 20:21701298-21701320 GTCGGGTCAGCTGTGGTGGATGG - Intergenic
1171139319 20:22727565-22727587 TTCCAGGAAGCAGGGGTGGAGGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173082097 20:39877964-39877986 GTCTGAACAGCAGTGGGGGAAGG - Intergenic
1173539684 20:43842268-43842290 CTGCAGACAGCAGGGGTAGATGG - Intergenic
1174202654 20:48818118-48818140 TTCCAGACAGCACAGGTGCAAGG + Intronic
1175008975 20:55715494-55715516 GTTCACTCAGCAGTGGTAGAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179558433 21:42195324-42195346 GGCCAGAGAGCAGTGGCTGAAGG + Intergenic
1179565857 21:42248328-42248350 GTCCAGACAGCAGTGGTGGAGGG + Intronic
1180593733 22:16960774-16960796 GGCCAGGCTGCAGTGGAGGAAGG - Intergenic
1181766105 22:25093227-25093249 GTCCACAGCGCATTGGTGGAGGG + Intronic
1182221360 22:28761554-28761576 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1183050001 22:35253197-35253219 ATCCTGACAGCAATGGCGGATGG + Intergenic
1184744948 22:46450758-46450780 GTCCTGACAGCAGTGCTGTGGGG - Intronic
1184849681 22:47113060-47113082 GTGCAGAGAGCAGTGCTGGCTGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951252941 3:20415589-20415611 GTCCAGAAAGAAGTGGTAGCTGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953782175 3:45880846-45880868 GTACAGACAGAGGTGATGGAGGG - Intronic
954572853 3:51656609-51656631 GGCCAGTCAGCAGTGGTGGCAGG + Intronic
954911515 3:54114557-54114579 GGCCAGGCAGCAGTGGTGGGGGG + Intergenic
954981508 3:54750199-54750221 GTCTAGACAGCAGAGGAGGCTGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
959631176 3:108508932-108508954 GTCCCCACAGCAATGGAGGAAGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960703897 3:120463587-120463609 GTCCAATCAGCTGTGGTGCAGGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
968534348 4:1113820-1113842 GGCGCGACAGCAGTGGGGGAGGG + Intergenic
968846014 4:3041909-3041931 GCCCTGACAGCAGTGGAGAATGG - Intergenic
968966135 4:3769921-3769943 ATACAGACAGCAGTGGGGGCAGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969834751 4:9831534-9831556 TTACAGACAACAGTGGTGTAGGG - Intronic
971980348 4:33742943-33742965 GGCAAAACATCAGTGGTGGACGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979565597 4:122151408-122151430 GCCCAGACAGAAGTGGTTTATGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
982222106 4:153133929-153133951 GTCCAGATAAAAGTGGTAGAGGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
986215428 5:5714986-5715008 AGCCAGACAGCAGTTGAGGAGGG + Intergenic
987047351 5:14120359-14120381 GCCCAGACAACAGTGGAGGTTGG + Intergenic
987183028 5:15386281-15386303 GTCCTCACAGCAGCTGTGGAAGG - Intergenic
987508221 5:18800422-18800444 GGCAAAACAGCAGTGGTGGAGGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
991637911 5:68724752-68724774 GTCCAAGCAGCTGTGGTTGAGGG + Intergenic
991677793 5:69105947-69105969 TTCCAGACAGCAGTGGTGGGGGG - Intronic
992157809 5:73972100-73972122 GTCCCTTCAGCAGGGGTGGAAGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994296872 5:98100718-98100740 ATCAAGAAATCAGTGGTGGATGG - Intergenic
995125595 5:108574491-108574513 AGCGAAACAGCAGTGGTGGATGG + Intergenic
995441465 5:112197044-112197066 GACCACAAAGCACTGGTGGAGGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
999093605 5:148958643-148958665 GTTCAGACAGCAGTTCTGGGAGG + Intronic
1002790330 6:432849-432871 CTCCAGACATCAGTGGTGAGTGG + Intergenic
1004137746 6:12984422-12984444 GTCCAAACATCAGTTCTGGAAGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1007011949 6:38426521-38426543 GGCAAAACAGCAGTGGTGGATGG - Intronic
1007339677 6:41182769-41182791 GTCCAGTCAGCTGTGGGGAAGGG - Intergenic
1007618081 6:43194078-43194100 CTCCAGACAGAAGTGCTGGCTGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009312721 6:62174728-62174750 GTACAGACAGCAGTTGTCAAGGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012867773 6:104638664-104638686 GCCCAGAGACCAGTGGTGGTGGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013193260 6:107821832-107821854 GTCCAGGCAGAGGTGGTGGCTGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017014433 6:150088817-150088839 CTACAGCCATCAGTGGTGGAGGG + Intergenic
1017242877 6:152190318-152190340 TTCAAGACTTCAGTGGTGGAGGG - Intronic
1017366295 6:153644797-153644819 GTCCATATAACAGTGGTAGAGGG + Intergenic
1018422329 6:163650246-163650268 GTCCAGCCAGCAGAGGAGGGAGG - Intergenic
1020079697 7:5280917-5280939 GCCCAGACAGCAGCAGAGGAAGG + Intronic
1020105159 7:5419417-5419439 GTCCAGCCCGGAGTGGTGGCAGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023280112 7:38560597-38560619 ATCCAGACAGCACTGCTAGATGG + Intronic
1023481981 7:40644370-40644392 ATCCAGAAAGCAGTGATTGAGGG - Intronic
1023938790 7:44757248-44757270 TTCCTGACAGCTGTAGTGGAGGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024626451 7:51211983-51212005 ATCAAGAGAGCAGGGGTGGAGGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028180793 7:87721289-87721311 AGCCAGAAAGCAGAGGTGGATGG + Intronic
1028429184 7:90727386-90727408 GTCCAGAAAGAAGTGTTAGAGGG + Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030447259 7:109662486-109662508 GTTCAGCCAGCTGTGGTTGAGGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031259386 7:119498202-119498224 AGCCAGAGAGCAGAGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031992957 7:128209761-128209783 AGCCAGACAGCAGTGGGAGAAGG + Intergenic
1032783398 7:135182458-135182480 GTCCAGACAGCAAGGCTGAAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1038360171 8:26867089-26867111 TTAAAGACATCAGTGGTGGAGGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040518430 8:48153655-48153677 ACCCAGACAGCACTGGTAGAGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043543962 8:81294631-81294653 CCCCAGACAGCAGTGTTGGCTGG - Intergenic
1044428871 8:92085310-92085332 GGCCAGGAAGTAGTGGTGGAAGG - Intronic
1045109512 8:98926898-98926920 TTCCAGGCAGCAGTGGTGGGTGG + Intronic
1045348844 8:101319358-101319380 GTCCTGACAGCAAGGTTGGAAGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047743992 8:127830315-127830337 GGCCAGATAGCAGAAGTGGAGGG + Intergenic
1048449563 8:134521888-134521910 TTCCAGACAGCTGTGGTGTTGGG - Intronic
1049102770 8:140590958-140590980 AGCCAGGGAGCAGTGGTGGATGG - Intronic
1049428605 8:142549038-142549060 GCCCAGACAGTGGTGGTGGTCGG - Intergenic
1049447698 8:142638963-142638985 ATCCAGACAGCAGGAGAGGAGGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1053124345 9:35567573-35567595 GTCCAAAGAGGTGTGGTGGAGGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055198922 9:73632746-73632768 GGCCAGGCAGCAGTGATAGAAGG + Intergenic
1057839514 9:98474496-98474518 CTACAGAGAGCAGGGGTGGATGG + Intronic
1060410110 9:123394676-123394698 GTCCAGCCAGTGGTCGTGGAAGG - Intronic
1061262963 9:129490078-129490100 GTACAGCCAGGAGGGGTGGAGGG - Intergenic
1061477379 9:130877418-130877440 ACCCAGAAAGCAGTGGTGGCCGG + Intronic
1061627077 9:131847172-131847194 GTCCTTGCAGCAGGGGTGGAGGG - Intergenic
1062411785 9:136429426-136429448 GTCCATACAGCATGGGTGGCAGG - Exonic
1062572719 9:137193003-137193025 GCCCAGACAGCAGAGCAGGAGGG - Intronic
1188518494 X:31012763-31012785 AGCCAGATAGAAGTGGTGGAGGG - Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1191035014 X:56015680-56015702 ATACAGACTGCAGTGGAGGAAGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194600132 X:95910543-95910565 GTCCAGATAGTAGTGCTAGAAGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195664689 X:107418226-107418248 GTTCAGAAAGCAGTGTTGCAGGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198951538 X:142077920-142077942 GACCAGGGAGCAGTGCTGGATGG + Intergenic
1199250840 X:145659871-145659893 TTCCAGGCTGCAGTGGTGCAAGG - Intergenic
1199319627 X:146422954-146422976 GACCAGGGAGCAGTGCTGGATGG + Intergenic
1199432073 X:147773164-147773186 GGCAAAACAGCAGTGGTGGATGG - Intergenic
1199618075 X:149674585-149674607 GTCAAGACAGTAGTGGTACAAGG + Intergenic
1199624567 X:149728664-149728686 GTCAAGACAGTAGTGGTACAAGG - Intergenic
1200109892 X:153735377-153735399 TTCCCGCCAGCAGTGTTGGAGGG + Intronic
1200180436 X:154147202-154147224 GTCCCAGCAGCAGTGGGGGAGGG - Intronic
1200186264 X:154185597-154185619 GTCCCAGCAGCAGTGGGGGAGGG - Intergenic
1200191916 X:154222735-154222757 GTCCCAGCAGCAGTGGGGGAGGG - Intronic
1200197671 X:154260539-154260561 GTCCCAGCAGCAGTGGGGGAGGG - Intronic
1201145716 Y:11064417-11064439 GCCCAGACAGCAGGGGAGGAGGG + Intergenic