ID: 1179566527

View in Genome Browser
Species Human (GRCh38)
Location 21:42252494-42252516
Sequence CCTAACCTGCCCCAGCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179566527_1179566530 16 Left 1179566527 21:42252494-42252516 CCGGGCAGCTGGGGCAGGTTAGG 0: 1
1: 0
2: 2
3: 34
4: 318
Right 1179566530 21:42252533-42252555 TCCTGTTTGAGACTCAGCCATGG 0: 1
1: 0
2: 3
3: 22
4: 164
1179566527_1179566532 25 Left 1179566527 21:42252494-42252516 CCGGGCAGCTGGGGCAGGTTAGG 0: 1
1: 0
2: 2
3: 34
4: 318
Right 1179566532 21:42252542-42252564 AGACTCAGCCATGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 25
4: 183
1179566527_1179566533 29 Left 1179566527 21:42252494-42252516 CCGGGCAGCTGGGGCAGGTTAGG 0: 1
1: 0
2: 2
3: 34
4: 318
Right 1179566533 21:42252546-42252568 TCAGCCATGGCTGCTTTGGATGG 0: 1
1: 0
2: 1
3: 25
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179566527 Original CRISPR CCTAACCTGCCCCAGCTGCC CGG (reversed) Intronic
900641841 1:3691309-3691331 CCTGCCCTGCCCCAGCTGCCAGG + Intronic
900985774 1:6072136-6072158 CCTAACCAAGCACAGCTGCCCGG - Intronic
901211371 1:7527934-7527956 CCAAACCTTCCCCAGCTTCTTGG - Intronic
901527183 1:9831013-9831035 CCTCACCTTCCCCAGAGGCCAGG + Intergenic
901871169 1:12140156-12140178 CCACACCTGAGCCAGCTGCCTGG - Intronic
902188181 1:14741030-14741052 ATGATCCTGCCCCAGCTGCCTGG - Intronic
902400663 1:16155227-16155249 CCTAACCTGCCCCGGGAGCCCGG + Intronic
902776724 1:18679538-18679560 CCTCCCCTGCTCCAGCTTCCTGG + Intronic
903183177 1:21615241-21615263 CCTAACCTCCCCTCTCTGCCAGG + Intronic
904419419 1:30382066-30382088 CTCAACCTGCCCCAGATGGCAGG + Intergenic
904541960 1:31239456-31239478 CCCACCCTGCCCCGACTGCCTGG + Intronic
905308491 1:37034417-37034439 TCCCACCTGCCCCGGCTGCCGGG + Intergenic
906290089 1:44614202-44614224 CCCAATTTGCCCCATCTGCCAGG + Exonic
906546440 1:46622622-46622644 CCTAAATTACACCAGCTGCCTGG + Intergenic
907034298 1:51202561-51202583 CCTATCCTGTGCCAGCTGTCAGG - Intergenic
907303079 1:53500321-53500343 CGGAGCCTGCCCCAGCTGCCAGG + Intergenic
907318630 1:53588812-53588834 TATGACCTGCCTCAGCTGCCTGG - Intronic
907951734 1:59189845-59189867 CCTACCCTTCCCCACCTCCCTGG + Intergenic
908597246 1:65701358-65701380 CCTAGCCTGCCCCAGCCCCATGG + Intergenic
909638789 1:77848747-77848769 ATTAACCTGCACCATCTGCCTGG - Intronic
910801274 1:91149122-91149144 CCATACCTGCCCCACCTCCCTGG - Intergenic
910884232 1:91949254-91949276 CCTAACAGGCCTGAGCTGCCCGG + Intergenic
911102336 1:94104588-94104610 CTTCCCCTGCCCCAGCTGCATGG - Intronic
912332780 1:108834766-108834788 CCTCACCTGCCCCACCAGCAGGG - Intronic
913450230 1:118987994-118988016 CCTACGCTGGCCCAGCTGCTAGG + Intronic
914356386 1:146888059-146888081 CCTATGCTGCCCCAGATTCCGGG + Intergenic
916739021 1:167632010-167632032 CCTAATCTGCCAGAGCTTCCTGG - Intronic
917651988 1:177087133-177087155 ACTAACATGCTTCAGCTGCCAGG - Intronic
918103719 1:181398607-181398629 CACACCCTGCTCCAGCTGCCAGG - Intergenic
919053057 1:192534973-192534995 CCTATACTGCTCCAGCTGGCTGG - Intergenic
919419730 1:197355458-197355480 CCTGAGCAGCCCCAGCTTCCAGG - Intronic
919799731 1:201346404-201346426 CCCAGCCTGCCCCAGCTCCCTGG + Intergenic
919811972 1:201414490-201414512 CCTGCCCCGCCCCACCTGCCAGG + Intronic
920176159 1:204103204-204103226 CCCAACTTGCCAGAGCTGCCTGG + Intronic
920432581 1:205928261-205928283 CCTAACTTGCCCAAGGTCCCCGG + Intronic
920457212 1:206110305-206110327 GCTGACCCGCTCCAGCTGCCCGG - Exonic
920933309 1:210408667-210408689 CCTTTCCTGCAGCAGCTGCCTGG - Intronic
924942850 1:248824637-248824659 CCTTTCCTGCCCCAGCAGACTGG + Intronic
1062883153 10:995024-995046 CCTAGCCTGCCCCACCTCCTGGG - Intronic
1063639281 10:7814510-7814532 CCCACCCCGCCCCAGCTGCAGGG - Intergenic
1063962030 10:11314648-11314670 CCTGACTTCCCACAGCTGCCTGG - Intronic
1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG + Intergenic
1064280404 10:13946135-13946157 CCTTTCCTGACCCAGATGCCTGG + Intronic
1064644380 10:17445879-17445901 CCTGACCTGCCGCTGCTGCCAGG - Intronic
1067555022 10:47263367-47263389 CCTAATCAGCACCAGCTGCAAGG + Intergenic
1068648204 10:59492889-59492911 CCCCACCTGCCCCAGCTGCAGGG + Intergenic
1069089314 10:64180140-64180162 CCAAACCTGGCACTGCTGCCTGG - Intergenic
1069883170 10:71606842-71606864 CCAAAGCTTCCCAAGCTGCCTGG - Intronic
1070924255 10:80207657-80207679 CCTACCCAGCCCCCACTGCCTGG + Intergenic
1071480988 10:86064804-86064826 CCTTTCCCTCCCCAGCTGCCTGG + Intronic
1073726337 10:106235419-106235441 CATAACTGGACCCAGCTGCCAGG + Intergenic
1074826421 10:117218151-117218173 CCTAAGCTTCCTCAGCTTCCCGG - Intergenic
1075047526 10:119158160-119158182 CCTCTCCTGCCCCAGCTCCTTGG - Intronic
1075545517 10:123351766-123351788 CCAAACCCGGCCCAGGTGCCTGG + Intergenic
1076435925 10:130441207-130441229 CCTGACCTTCCCCAGATCCCAGG - Intergenic
1076769787 10:132656667-132656689 GCTCACCTGGCCCAGCTGGCTGG - Intronic
1076797860 10:132807541-132807563 CCTGTCCTGACCCAGCTGTCTGG + Intergenic
1077143918 11:1036444-1036466 CGTGACCAGCCCCCGCTGCCAGG - Intronic
1077406062 11:2383070-2383092 CCTCACATCCCCCAGCTGGCGGG + Intronic
1077582196 11:3423476-3423498 CCTAACCGGCCCCGACTCCCGGG - Intergenic
1077815213 11:5680120-5680142 GGTGACCTGCCCCATCTGCCTGG - Exonic
1077817059 11:5696268-5696290 GGTGACCTGCCCCATCTGCCTGG + Exonic
1078070588 11:8106700-8106722 TCAAATCTGCCACAGCTGCCCGG - Intronic
1079457508 11:20649992-20650014 AATCACTTGCCCCAGCTGCCTGG + Intronic
1081609980 11:44556070-44556092 CCTCACCTGGCCCTGCAGCCAGG + Intergenic
1082004611 11:47412583-47412605 CCCAACCTCCCGCAGCTCCCAGG - Intronic
1083720771 11:64602452-64602474 GCTTGCCTGCCCCAGGTGCCAGG + Intergenic
1083924683 11:65798721-65798743 CCTACACTGCCCCTGCTTCCTGG - Intergenic
1084093609 11:66895328-66895350 CCCCACCTGCTCCAGCTCCCAGG + Intronic
1084239118 11:67806293-67806315 CCTAACCGGCCCCGCCTCCCGGG - Intergenic
1084495811 11:69502461-69502483 CCTAACCAGCCCCACCTGGCTGG + Intergenic
1085195788 11:74670819-74670841 CTTAACCCGCCCCAGCTGCAGGG - Intergenic
1089290997 11:117437865-117437887 CCTTCCCTGCCCCAGTGGCCTGG + Intronic
1089300355 11:117495119-117495141 CCTACCCTGGCCCAGCTCCATGG - Intronic
1089335706 11:117722148-117722170 GCTAACCAGCCCCAGCTCCTGGG + Intronic
1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG + Intergenic
1089650973 11:119912633-119912655 CCTCACCCTCCCCAGATGCCGGG - Intergenic
1089655199 11:119942065-119942087 GCTGACCTGGCCCAGGTGCCAGG - Intergenic
1090277068 11:125427778-125427800 CCAAACCTCCCCTAGCTTCCAGG + Intronic
1090941123 11:131389237-131389259 CCTTACCTGCCCCAGGTGACAGG + Intronic
1091060583 11:132457739-132457761 GCACTCCTGCCCCAGCTGCCTGG + Intronic
1095696333 12:45148116-45148138 CCTACCCTGCCCCAGGGGCTGGG - Intergenic
1096529523 12:52234146-52234168 CCTCCCCTCCCCCACCTGCCTGG + Intronic
1097261095 12:57720699-57720721 CCTGCCTTCCCCCAGCTGCCTGG + Intronic
1099365607 12:81762968-81762990 CCTACCCTGAGGCAGCTGCCAGG + Intergenic
1100472823 12:94908897-94908919 CCCCACCTGCACCAGCTGCTAGG + Intronic
1102435453 12:112919251-112919273 ACTAACAAGCCCCAGCTGCTGGG - Intronic
1102681743 12:114695139-114695161 CCTCTCCTGCCCCAGCCTCCAGG - Intergenic
1103568503 12:121829220-121829242 CCACTCCTGCCCCAGCAGCCAGG - Intronic
1103704911 12:122866159-122866181 CCTTAGCTTCCCCAGGTGCCGGG - Exonic
1103715769 12:122944593-122944615 CCTCACCTCCCCCTGCAGCCTGG - Intronic
1103913017 12:124362533-124362555 GAAAGCCTGCCCCAGCTGCCCGG + Intronic
1103913067 12:124362681-124362703 CAGAACCTGGCCCAGCTGCCTGG + Intronic
1103913111 12:124362828-124362850 CAGAACCTGGCCCAGCTGCCTGG + Intronic
1104364097 12:128161456-128161478 CCTAACCTGCCCAAGATACATGG - Intergenic
1104985793 12:132596297-132596319 CCTCACCTGCCCTTGCTGACAGG + Intergenic
1105210817 13:18255769-18255791 CCAAACCTGCCCCTTCTGCAGGG - Intergenic
1105780632 13:23702563-23702585 CCTGCCCCGCCCCTGCTGCCAGG + Intergenic
1112576739 13:100642892-100642914 CTTTACCTGCCCCAGGTGCTAGG - Intronic
1113469164 13:110532138-110532160 CAGACCCTGACCCAGCTGCCAGG + Intronic
1113886015 13:113658679-113658701 CCAACCCAGCTCCAGCTGCCAGG - Intergenic
1114184712 14:20391669-20391691 CACAGCCTGCCCCTGCTGCCAGG - Exonic
1117094771 14:52285759-52285781 CATAGCCTGACCCAGCTTCCAGG + Intergenic
1118280674 14:64425522-64425544 TCTAACATGCACCAGCTGACAGG + Intronic
1118338933 14:64879273-64879295 CCTCACCTGTCCCTCCTGCCTGG + Intronic
1121338871 14:93093308-93093330 TCTGCCCTGCCCCAGCGGCCAGG + Intronic
1122136228 14:99634539-99634561 CCTAAGCAGCCCCAGCTCCTGGG + Intergenic
1122408130 14:101512395-101512417 CCTGGCCTGCCCCCACTGCCTGG - Intergenic
1122814934 14:104307648-104307670 CCTCTCCTGCCCAGGCTGCCAGG - Intergenic
1202848501 14_GL000225v1_random:1281-1303 CCCAACCTGCCCCGGCAGGCGGG + Intergenic
1123432173 15:20227433-20227455 CCTAACCAGCACCAGCTGGTTGG - Intergenic
1125429329 15:39580395-39580417 CCTTTCCTGCCGCGGCTGCCAGG - Intergenic
1125432455 15:39609347-39609369 ACTGACCTGCCCTTGCTGCCTGG - Intronic
1125539082 15:40459398-40459420 CCTCACCTGCCCCTGCTGATGGG + Exonic
1126144092 15:45461185-45461207 CCTAACCCTCCCCATCTCCCAGG - Intergenic
1127977253 15:64006824-64006846 CCTCACCTCCTCCAGCTGCCAGG - Intronic
1129869020 15:78929113-78929135 CCCCACCTGCCCCATCTTCCTGG - Intronic
1129912116 15:79236517-79236539 CCTCTCCTGCTCCAGCAGCCCGG - Intergenic
1129921446 15:79322533-79322555 CCTAAGCTGCCCAAGAGGCCTGG - Exonic
1130300972 15:82679872-82679894 CCTATCCTGACCCAGCGCCCAGG + Intronic
1130608655 15:85340362-85340384 CCTCACCTCCCCCAGATGACAGG - Intergenic
1131419762 15:92295536-92295558 CTTAGCCTGTCCCAGCTCCCAGG + Intergenic
1132804029 16:1767483-1767505 CCAAACCTGCCACAGCTCCAGGG - Intronic
1133290182 16:4715358-4715380 CCCTGCCTCCCCCAGCTGCCTGG - Intronic
1133326421 16:4944936-4944958 CCTCTCCTGCTCCAGCTGCCAGG - Intronic
1134104797 16:11477788-11477810 CCTAACCTGCGCCAGCTCCCAGG + Intronic
1134179706 16:12037572-12037594 CCTAACCTCCCCCTACTGCAGGG - Intronic
1134598641 16:15515782-15515804 AGTAACCTGCCCAAGCTGACAGG - Intronic
1135306451 16:21371342-21371364 CCTAACCTCCCCCTACTGCAGGG - Intergenic
1135903600 16:26489918-26489940 CCCAGCCTGCCCCAGGTGACAGG + Intergenic
1136043570 16:27599046-27599068 GCTCACATGCCCCAGCTGCTGGG - Intronic
1136303194 16:29350485-29350507 CCTAACCTCCCCCTACTGCAGGG - Intergenic
1136737255 16:32475863-32475885 CCACAGCTGCCCCAGCTCCCCGG - Intergenic
1136852465 16:33623706-33623728 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1137811383 16:51356119-51356141 CCCAACCTACCTCATCTGCCTGG - Intergenic
1139649712 16:68356199-68356221 CCTGACCTGCTTCAGCTCCCAGG - Intronic
1139977630 16:70827404-70827426 CCTATGCTGCCCCAGATTCCGGG - Exonic
1140009688 16:71118796-71118818 GCTAAGCTGCCTCATCTGCCTGG - Intronic
1140219393 16:73032975-73032997 CCCATCCTGCTCCTGCTGCCTGG - Intronic
1141625897 16:85260922-85260944 CCTACCCTGGCCTAGCTGCAGGG + Intergenic
1141657717 16:85424978-85425000 CCTGCCCTGCTCCAGCTGCCTGG - Intergenic
1141722720 16:85765839-85765861 CCTCCCCTGCCCCAGGTCCCTGG - Intergenic
1142120082 16:88382932-88382954 CCTAAGCCGCCCCAGCCTCCGGG + Intergenic
1142197035 16:88743761-88743783 CCAAACCTGCCTCGGCTGCCTGG - Intronic
1142302559 16:89267012-89267034 CCTCACCAGCTGCAGCTGCCAGG + Intergenic
1142305351 16:89281393-89281415 GCTATCCTGCCCCAGCTACGAGG - Exonic
1142380873 16:89731144-89731166 CCTCACCTGCCCTGCCTGCCTGG - Intronic
1203015815 16_KI270728v1_random:353714-353736 CCACAGCTGCCCCAGCTCCCCGG + Intergenic
1203034150 16_KI270728v1_random:626872-626894 CCACAGCTGCCCCAGCTCCCCGG + Intergenic
1203114065 16_KI270728v1_random:1472174-1472196 CCTAACCAGCACCAGCTGGTTGG + Intergenic
1143104099 17:4519851-4519873 CCTATCCTGTCCCTTCTGCCAGG + Intronic
1143509753 17:7388914-7388936 CCTCTCCTGCCCCTGCCGCCTGG + Intronic
1144456416 17:15422587-15422609 ACTCACCCGCCCCAGCTCCCCGG - Intergenic
1144588768 17:16505968-16505990 CCTCACCTGTCCCAGCTTCTAGG + Intergenic
1144757048 17:17686172-17686194 CCTCACCTGGCCCTCCTGCCAGG - Intronic
1145018256 17:19412564-19412586 CCCTACCTGCTCCATCTGCCTGG + Exonic
1146667545 17:34715175-34715197 CCTGACCTGCCCCAGAGGCTGGG + Intergenic
1147057661 17:37846700-37846722 GCTGACCTGCCCCAGATGACAGG - Intergenic
1147212451 17:38879810-38879832 ACTAACCTGCACCAGGTGCTGGG + Intronic
1147306039 17:39565051-39565073 CCTTCCCTGCCCCTGCTTCCTGG + Intergenic
1147359597 17:39922581-39922603 CCCAAGCTGCCCCAGCTCCACGG - Exonic
1147429358 17:40362055-40362077 CCTAACCCAGCCCACCTGCCAGG - Intronic
1147599084 17:41734670-41734692 TATAACCTGCGCCAGCCGCCGGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148794301 17:50189795-50189817 CCTCACCTGCCACCGCTGCCTGG + Intronic
1148861088 17:50604656-50604678 GCTAACCTGGCCCAGCTGTCTGG - Intronic
1150520840 17:65865718-65865740 CCTCACCTGCCACTGCTGCAGGG + Intronic
1151456921 17:74232006-74232028 CCTTTTCTACCCCAGCTGCCTGG + Intronic
1151728300 17:75896889-75896911 GCTGACCTGCGCCATCTGCCTGG - Exonic
1152207272 17:78980848-78980870 CCCCACCGGCCCCAGCAGCCTGG - Intergenic
1152229316 17:79106596-79106618 CCACACCTGCCCCAGCTCCAGGG - Intronic
1152468212 17:80477228-80477250 CCTCCCCTCCCCCAGCTCCCGGG + Intronic
1152655044 17:81515307-81515329 CCTCCCCAGGCCCAGCTGCCCGG - Intronic
1155761507 18:29574581-29574603 ACTTACCTTCCTCAGCTGCCAGG + Intergenic
1157304774 18:46508961-46508983 CCTCACCTTCCCCAGCTGTGCGG - Intronic
1158888505 18:61851422-61851444 CCTGAGCTGCCCCAGCTTCAGGG + Intronic
1160024656 18:75208199-75208221 CCGACCCTGGCCCAGCTGCCCGG + Intronic
1160217357 18:76944182-76944204 ACGCAGCTGCCCCAGCTGCCAGG + Intronic
1160499490 18:79395115-79395137 GCTCACCTGCCCTAGCCGCCCGG - Intergenic
1160854847 19:1212121-1212143 CCAGGCCTGCCCCAGCTGGCTGG - Intronic
1161668410 19:5590624-5590646 CCTGAGCTGCCCCAGGAGCCAGG + Intronic
1161766281 19:6210772-6210794 CCCACCCCACCCCAGCTGCCCGG - Intergenic
1162024866 19:7888260-7888282 CCTCAGTTTCCCCAGCTGCCAGG + Intergenic
1162774334 19:12969866-12969888 CCTGCCCATCCCCAGCTGCCTGG - Exonic
1163811713 19:19436662-19436684 GCTAAGCTGCCCCCGCTGCGTGG + Intronic
1165226708 19:34360006-34360028 CCTAACTTGCCTCTGCTGTCAGG + Intronic
1166328532 19:42065713-42065735 CTTCGCCAGCCCCAGCTGCCAGG - Exonic
1167246010 19:48373645-48373667 CCTGGCCTTCCTCAGCTGCCTGG + Exonic
1168241830 19:55092537-55092559 CCTCCCCTGCCCCAGCACCCTGG - Exonic
925860791 2:8173258-8173280 CCTCCCCAGCCCCAGCAGCCAGG - Intergenic
926133946 2:10323465-10323487 CCTAACGTGCGCCCACTGCCAGG - Intronic
926161773 2:10494697-10494719 CCTCACCTGGCCCACCTGCAAGG - Intergenic
926312845 2:11686854-11686876 CCTCTTCTGCCCCAGCTGCTGGG + Intronic
927967846 2:27282800-27282822 GCTCATCTGCCCCATCTGCCTGG + Exonic
928029806 2:27768569-27768591 CCTGACCTGTCCCAGGGGCCTGG - Intergenic
929935657 2:46292793-46292815 CCTGGACTGGCCCAGCTGCCGGG - Intergenic
933609010 2:84414920-84414942 CTTAACCTTCCCCAGCTGCTAGG + Intergenic
933899501 2:86839576-86839598 CCCAGCCTGCTCCAGCTCCCTGG + Intronic
934544763 2:95205788-95205810 CCCCACCAGCCCTAGCTGCCTGG + Intergenic
934717687 2:96552926-96552948 CCTCCCCTGCCCCTCCTGCCAGG - Intergenic
935781061 2:106509650-106509672 CCCAGCCTGCTCCAGCTCCCTGG - Intergenic
936045339 2:109183741-109183763 CCTGACCTGACCGAGCTGCTGGG - Intronic
937356503 2:121201286-121201308 CCTAACGCACCCCAGATGCCCGG + Intergenic
944080931 2:195787767-195787789 TCCACCCTGCCCCAGCTGCAGGG - Intronic
945121700 2:206463722-206463744 CCTGACCTGCCCCTGATCCCGGG - Intronic
946377127 2:219318280-219318302 ACTCACCTGCCTCAGCTTCCCGG + Intergenic
948334090 2:237194185-237194207 ACTCACCTGCCCCAGCTGCTGGG + Intergenic
948809516 2:240467525-240467547 CCTCCTGTGCCCCAGCTGCCAGG + Exonic
948890030 2:240903117-240903139 CTTGTCCTGCCCCACCTGCCTGG - Intergenic
948922189 2:241071024-241071046 CCCAGCCTGCCCCTTCTGCCTGG - Intronic
1171486676 20:25490793-25490815 CCACACCTGCCCCACCTCCCGGG - Intronic
1172095134 20:32456800-32456822 CCCACCCTGCTCCTGCTGCCGGG + Intronic
1172637588 20:36420431-36420453 CCCTACCTGATCCAGCTGCCTGG - Intronic
1174451897 20:50625736-50625758 CCTACTCTGCCCCAGTTGACAGG - Intronic
1175320543 20:58084738-58084760 CGGAGCCTGCCCCAGCTCCCCGG + Intergenic
1175333028 20:58177688-58177710 CCAAACCCTCCCCTGCTGCCTGG + Intergenic
1175417881 20:58813382-58813404 CCTGAGCTGCCACAGCTGCCGGG + Intergenic
1175688276 20:61047122-61047144 CCCCAGCTGCCCCAGCTCCCAGG + Intergenic
1175829285 20:61953310-61953332 GCTCAGCTGCCCCAGCGGCCTGG - Intergenic
1175938117 20:62524486-62524508 CCTTACCTGCCCCATCTGGGTGG + Intergenic
1175960579 20:62634523-62634545 CCTAGCCTGCCCTGCCTGCCGGG + Intergenic
1176112783 20:63418126-63418148 GCCAGCCTGCCTCAGCTGCCAGG + Intronic
1176132921 20:63503802-63503824 CCTGCCCTGGCCCAGCTGCTCGG - Intergenic
1176173903 20:63708680-63708702 GCTGACCTGCGCCAGCTGCAGGG + Exonic
1176256656 20:64156545-64156567 CCTAGGCTGCCCCTGCTGCAGGG + Intronic
1179525640 21:41974261-41974283 CCTGACCTGCCCCAGGGGACCGG - Intergenic
1179566527 21:42252494-42252516 CCTAACCTGCCCCAGCTGCCCGG - Intronic
1180414282 22:12693985-12694007 CCCAACCTGCCCCAGCACGCGGG - Intergenic
1180858338 22:19062320-19062342 CCTGCCCTGTCCCAGCAGCCAGG + Intronic
1180904802 22:19401967-19401989 CCTCCCCCGCCCCAGCTCCCAGG + Intronic
1181431445 22:22884166-22884188 TTTAACCTCCACCAGCTGCCTGG - Intronic
1181572228 22:23773814-23773836 CCTTCCCTGCCCGAGCTGTCTGG - Intronic
1181601538 22:23955110-23955132 CCTTCCCTGCCCCTGCTGCCAGG + Intergenic
1181701961 22:24626575-24626597 CCAAACCTGCCCCTTCTGCAGGG + Intronic
1182368694 22:29796045-29796067 CCTGACCTGCCCTGGCTGCCAGG - Intronic
1183264326 22:36816301-36816323 TCTCACCTCTCCCAGCTGCCCGG - Intronic
1183429878 22:37759103-37759125 CCAGCCCTGCCCCAGCTTCCAGG + Intronic
1183509681 22:38227466-38227488 CCTCACCTGCGCCGGCTTCCCGG - Intronic
1184335988 22:43853529-43853551 CCCAGCATGCCACAGCTGCCTGG - Intronic
1184433119 22:44453263-44453285 GCTCAGCTGCCCCAGCTGACTGG - Intergenic
1184476996 22:44727327-44727349 CCTCACCTGACCCCGCTCCCAGG - Intronic
1185207277 22:49547342-49547364 GCTAACGTACCCCAGGTGCCTGG + Intronic
1185259460 22:49853677-49853699 CCGACCCCGCCCCAGCGGCCGGG + Intergenic
1185388761 22:50548063-50548085 CATCCCCTGCCCCAGCTGACGGG + Exonic
950194167 3:10997392-10997414 CCCATCCAGCCCCAGCAGCCAGG - Intronic
950408308 3:12817939-12817961 CTCACTCTGCCCCAGCTGCCTGG - Intronic
950537101 3:13585004-13585026 CCAACCCAGCCCCAACTGCCAGG - Intronic
952042885 3:29281397-29281419 CCTGGCTTCCCCCAGCTGCCGGG - Exonic
952991920 3:38837634-38837656 CCTAGCCTGCACCATCTCCCGGG - Intergenic
953072821 3:39539718-39539740 CCTATCCTGCTCCTGCTGCTTGG + Intergenic
953482987 3:43268267-43268289 AATAACCTGCCCCAGCTGAAAGG - Intergenic
953780976 3:45870141-45870163 GCTACCCTGCCCCTCCTGCCAGG - Intronic
953883105 3:46701564-46701586 CCTCACCTCCACCAGCTGCCCGG - Exonic
954368054 3:50156480-50156502 CCCAACCTGGCCCAGCTTCAGGG - Intronic
954445701 3:50545782-50545804 CCTAACCTTTCCCAGGTTCCTGG + Intergenic
954603787 3:51893274-51893296 GCTAACCTTCCCCACCTTCCAGG - Intergenic
960706717 3:120489496-120489518 CCTAACATTCCCAAGTTGCCAGG - Intergenic
961169248 3:124784758-124784780 CTTAACCTGCCCAATCCGCCTGG + Intronic
961299797 3:125915622-125915644 CCTAACCGGCCCCACCTCCCGGG + Intergenic
961516362 3:127439856-127439878 GCTAAGCTGCCCCTGCTCCCAGG - Intergenic
961779541 3:129313644-129313666 CCTGCCCTGCCCAAGCTCCCTGG - Intergenic
962311911 3:134332675-134332697 TCTGCCCTGCTCCAGCTGCCTGG + Intergenic
962381449 3:134901508-134901530 CCAAACCTGCCCAAGCCTCCAGG - Intronic
962429638 3:135307326-135307348 GCTGCCCTTCCCCAGCTGCCTGG + Intergenic
962613718 3:137103584-137103606 CCTCACCTCCCCCAGAGGCCTGG - Intergenic
966125446 3:176571223-176571245 CCTTATCTGCACCAGCTTCCAGG + Intergenic
966861085 3:184231072-184231094 CCTGACCTGCGCCAGGTGCTGGG + Intronic
967037356 3:185657852-185657874 CTTGACCTGACCCAGCTGCACGG + Intronic
968283456 3:197494361-197494383 CCTAGCCTGCCCCACTTTCCTGG - Intergenic
968502171 4:955903-955925 CGTCACCTGCCCCAGCTATCAGG + Intronic
968610960 4:1556801-1556823 CCTACACTGCACCAGCTCCCGGG + Intergenic
968629516 4:1642764-1642786 CCTACCCAGCCCCACCTGCCGGG + Intronic
968731404 4:2270969-2270991 ACTGCCCAGCCCCAGCTGCCAGG + Intronic
968756877 4:2420958-2420980 ACAACCATGCCCCAGCTGCCAGG + Intronic
968997859 4:3956358-3956380 CCTAACCGGCCCCGCCTCCCGGG - Intergenic
969580585 4:8062290-8062312 CCTGACGTGGCCCAGGTGCCAGG - Intronic
969816464 4:9691462-9691484 CCTAACCGGCCCCGCCTCCCGGG + Intergenic
976680521 4:87750886-87750908 CATATCCTGCGCCAGCTGCATGG + Intergenic
976965627 4:91036844-91036866 CCTCAACTGACCCACCTGCCTGG - Intronic
981691093 4:147509924-147509946 ACCATCCTGCCCCCGCTGCCAGG + Intronic
982780339 4:159483801-159483823 CCTGCCTTGCCTCAGCTGCCTGG + Intergenic
984845815 4:184107061-184107083 CCCAACCTGCCCCAGGCCCCTGG + Intronic
987092192 5:14518038-14518060 CCTAACCTGCGCTCACTGCCTGG - Intronic
987286842 5:16465741-16465763 CTTAACCCGCCTCAGCAGCCAGG + Exonic
991049414 5:62256440-62256462 CCTAACCAGCACCAGCTGGTTGG - Intergenic
991438216 5:66617904-66617926 CCTATCCAACCCCAGCTGCCAGG - Intronic
992747637 5:79835202-79835224 CCCAAGCTGTTCCAGCTGCCAGG + Intergenic
997615963 5:135246402-135246424 CCTCTCCTGCCACAGCTGCAGGG + Intronic
998407131 5:141880299-141880321 CCCCTCCTACCCCAGCTGCCAGG + Intergenic
999120681 5:149207145-149207167 CTGCTCCTGCCCCAGCTGCCTGG + Intronic
999714866 5:154352508-154352530 CTTAACCTCTCCCAGCTGCAGGG - Intronic
999722835 5:154411624-154411646 CCTTGCCTGGCTCAGCTGCCTGG + Intronic
1000247368 5:159459918-159459940 CATAACCTGACGCACCTGCCAGG + Intergenic
1001791764 5:174463781-174463803 CCTACCCTGTGCCAGTTGCCAGG - Intergenic
1001822501 5:174721093-174721115 CCTGCCCCGCCCCCGCTGCCCGG - Intergenic
1001934582 5:175695119-175695141 CCCAGCCTGCCCCACCTGACAGG + Intergenic
1002065954 5:176651726-176651748 CCACACCTGCCTCTGCTGCCCGG + Intronic
1004650223 6:17600793-17600815 CCTCACCTGGCACAGCGGCCTGG + Exonic
1006642994 6:35497944-35497966 CCTAGCCCGCCCCAGCTCCTCGG + Exonic
1012477723 6:99633387-99633409 CCAATCCTGCCCCAGCTCCAGGG - Intergenic
1013976706 6:116087438-116087460 CCTAAGCTGCCCCACCTAACTGG + Intergenic
1017563807 6:155662782-155662804 CCTAACCTACCCTATCTGCCAGG - Intergenic
1019145375 6:169972386-169972408 CCTAGCCTCCCCCCACTGCCTGG - Intergenic
1019413040 7:914869-914891 TCTACCCTGCCCCTGCAGCCTGG - Intronic
1019559836 7:1650553-1650575 CCTAACCAGCCTCATCTGCCTGG - Intergenic
1020234098 7:6342088-6342110 CCTACCCTACGCCAGGTGCCAGG + Intronic
1023897377 7:44445189-44445211 CCTGAACTGCAACAGCTGCCTGG + Intronic
1024041670 7:45560693-45560715 CCTTACCTACCCCAAGTGCCAGG - Intergenic
1024081729 7:45862272-45862294 CCTACCCTGCCCCTGATACCAGG + Intergenic
1029338095 7:99919353-99919375 GTTGACCTGCCCCATCTGCCTGG - Exonic
1029523185 7:101077480-101077502 CCTGCCCTTCTCCAGCTGCCTGG + Intergenic
1032536232 7:132666944-132666966 CCAAAGCTGGCTCAGCTGCCTGG + Intronic
1033544618 7:142388938-142388960 CCTACACTGCTCCAGCTCCCAGG - Intergenic
1033555093 7:142482288-142482310 CCTACACTGCCCCAGCTCACAGG - Intergenic
1033557260 7:142499801-142499823 CCTACACTGCCCCAGCTCACAGG - Intergenic
1034057291 7:148048544-148048566 CCTGACATGCCCCAGCTCCATGG - Intronic
1034467229 7:151237306-151237328 CCTACCCAGCTCCAGCTGCCTGG - Intronic
1035165290 7:156985771-156985793 CCCAGGCTGCACCAGCTGCCTGG + Intergenic
1035531453 8:355008-355030 CCTTCCCTGCTCCAGTTGCCAGG + Intergenic
1036165551 8:6429494-6429516 CCTCCCCCGCCCCAGCTGCCAGG + Intronic
1037359113 8:18054333-18054355 CCTAGCCTGCCACAGCTTCCTGG + Intergenic
1038666688 8:29543577-29543599 TTTATCCTGCCTCAGCTGCCTGG - Intergenic
1038805866 8:30790669-30790691 CCTTCCCTGCCCCAGCTCCTGGG - Intronic
1041271939 8:56117697-56117719 CCTGAGCCGCCCCAGCTCCCGGG + Intergenic
1041730129 8:61054268-61054290 CCTACCTTGCCCCAGATTCCAGG - Intergenic
1042689964 8:71486669-71486691 CCTGATCTGCCCCTGCTGTCAGG - Intronic
1044529188 8:93289002-93289024 CCTCACCTGCCCCACCTGTAGGG + Intergenic
1044944232 8:97375854-97375876 CCACACCATCCCCAGCTGCCAGG - Intergenic
1045390014 8:101705793-101705815 CCTCAGCTGCTCCAGCTCCCAGG + Intronic
1048971169 8:139645651-139645673 CTGCACCTGCCCCAGCAGCCTGG + Intronic
1049586587 8:143435267-143435289 CCCACCCTGCTCCTGCTGCCCGG + Intergenic
1049783446 8:144439380-144439402 CCCAACTTCCCACAGCTGCCTGG + Intronic
1051658914 9:19408456-19408478 CCCAACCTGCTCCAGCAGCCGGG + Intergenic
1052341348 9:27367097-27367119 CCCACCCTGCTCCAGGTGCCAGG - Intronic
1053089239 9:35258694-35258716 CCAAACCTTCTCCAGCTGCCTGG + Intronic
1054798511 9:69324975-69324997 CCGAACCTGCGCCGGCTTCCTGG - Intronic
1056585634 9:87925561-87925583 ACTAACCAGGCCCTGCTGCCAGG + Intergenic
1056611245 9:88127383-88127405 ACTAACCAGGCCCTGCTGCCAGG - Intergenic
1058753493 9:108062940-108062962 ACTACCCAGCCCCAGCTTCCAGG - Intergenic
1058884461 9:109312942-109312964 CCAAACCTTCTCCAGCTGCCCGG + Intronic
1059242601 9:112820011-112820033 CCTCACAGGCACCAGCTGCCAGG - Intronic
1059343512 9:113612958-113612980 CCTGGCCTGGCCGAGCTGCCTGG + Intergenic
1060961447 9:127683568-127683590 CCTGAGCTGCCCCAGCTGGGAGG + Intronic
1061543224 9:131289503-131289525 GCCTGCCTGCCCCAGCTGCCGGG - Intergenic
1062100446 9:134725224-134725246 CTGATCCTGCCCCAGCTGCTGGG + Intronic
1062430618 9:136525467-136525489 CCTCAGCGGCCCCAGCGGCCCGG + Intronic
1187297460 X:18015713-18015735 CATTAAGTGCCCCAGCTGCCAGG + Intergenic
1189219053 X:39355490-39355512 CCCAACTGGCACCAGCTGCCTGG - Intergenic
1190465506 X:50721935-50721957 CCTAGCCTAGCCCAGCTGGCTGG + Intronic
1191740527 X:64432530-64432552 CCCATCCTGCCCCCTCTGCCTGG + Intergenic
1194891278 X:99383350-99383372 CCTACCCTGCCACAGCAGCAGGG - Intergenic
1195564656 X:106326613-106326635 CCAAACATGCTCCAGGTGCCTGG + Intergenic
1196124307 X:112082890-112082912 CCTCACCTCCCCCAGCCCCCGGG + Intergenic
1199799422 X:151234901-151234923 CCTAGTCTGTCCCAGATGCCGGG - Intergenic
1200116371 X:153771420-153771442 CCCACCCTGCCCCGCCTGCCTGG - Intronic