ID: 1179566583

View in Genome Browser
Species Human (GRCh38)
Location 21:42252813-42252835
Sequence CCTAAACCTGCTGCCAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179566583_1179566588 -9 Left 1179566583 21:42252813-42252835 CCCCCATTGGCAGCAGGTTTAGG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1179566588 21:42252827-42252849 AGGTTTAGGAAAGCCATCAGAGG 0: 1
1: 0
2: 2
3: 12
4: 157
1179566583_1179566589 -8 Left 1179566583 21:42252813-42252835 CCCCCATTGGCAGCAGGTTTAGG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1179566589 21:42252828-42252850 GGTTTAGGAAAGCCATCAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 139
1179566583_1179566595 25 Left 1179566583 21:42252813-42252835 CCCCCATTGGCAGCAGGTTTAGG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1179566595 21:42252861-42252883 CCCTGACATCATCCCCGCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 188
1179566583_1179566597 28 Left 1179566583 21:42252813-42252835 CCCCCATTGGCAGCAGGTTTAGG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1179566597 21:42252864-42252886 TGACATCATCCCCGCCCAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179566583 Original CRISPR CCTAAACCTGCTGCCAATGG GGG (reversed) Intronic
902138192 1:14329151-14329173 CCTAAAATTGATGCCAATGAAGG - Intergenic
902151836 1:14449496-14449518 CCTATTCCTGCTGCCCAGGGAGG - Intergenic
906160416 1:43644595-43644617 CCAAATCCTGCTGCCATTGGTGG + Intergenic
912653291 1:111460949-111460971 CCTAAAGCTGCTGGCAAAGAAGG + Exonic
918844584 1:189593478-189593500 GCTATACCTGCTCCCAATGCTGG - Intergenic
919745145 1:201004209-201004231 CCTAAACCTGCAGCCTAGGATGG + Intronic
920205146 1:204286018-204286040 CCTAAGCCTGCTGTCCTTGGTGG - Intronic
921748108 1:218760757-218760779 TGTAAACCTACTGCCAAAGGAGG + Intergenic
1064397741 10:14994862-14994884 CCTAAACGAGCTGCCGAGGGAGG + Intergenic
1073040427 10:100600601-100600623 CCTTAAACTGCTGAGAATGGGGG - Intergenic
1075817104 10:125272972-125272994 CCTAAACCAACAGCCAGTGGGGG - Intergenic
1077349984 11:2088576-2088598 CCTAAGGTTGCTTCCAATGGTGG + Intergenic
1077589494 11:3480598-3480620 CTTAAACGAGCTGCCAAGGGAGG + Intergenic
1082810742 11:57477372-57477394 CCTCAACCTCCTGACACTGGAGG + Exonic
1084245215 11:67852372-67852394 CTTAAACGAGCTGCCAAGGGAGG + Intergenic
1084261621 11:67982527-67982549 CGTAAACGAGCTGCCAAGGGAGG + Intergenic
1084576414 11:69991410-69991432 CCTACCCCTGCTGTCAATGGAGG - Intergenic
1084827473 11:71742206-71742228 CTTAAACGAGCTGCCAAGGGAGG - Intergenic
1086174955 11:83880159-83880181 CTTACACCTGTTGGCAATGGTGG + Intronic
1090694263 11:129221706-129221728 CCTAAAGCTGAGGCCAATAGTGG + Intronic
1093027434 12:14257859-14257881 CCTAAAGCTGCTGCCAGTAGTGG + Intergenic
1093393612 12:18653183-18653205 CCAAACCATGCTGCCAATGCTGG - Intergenic
1093541354 12:20289473-20289495 CCTAATCCTTTTGCCATTGGAGG - Intergenic
1099076779 12:78119485-78119507 CCAAAATCTGCTGCCATTGGCGG + Exonic
1100285722 12:93164706-93164728 CCCATACCTGCTGCCAAAAGAGG - Intergenic
1101237224 12:102802032-102802054 TCTAGAACTGCTGCCAAAGGTGG + Intergenic
1103202631 12:119100817-119100839 CCTAAACCTCCCTCCTATGGGGG - Intronic
1107854892 13:44605052-44605074 CCTAATCCTGCTGCAAGTGCTGG - Intergenic
1109609463 13:64744307-64744329 CCTGAAGCTGCAGCCAATGCTGG - Intergenic
1111094987 13:83501372-83501394 CCTGAAACTGCTGCTCATGGTGG + Intergenic
1115870320 14:37793513-37793535 CCTTACTCTGCTGACAATGGAGG + Intronic
1118730097 14:68659831-68659853 GCTCAGCCTGCTGCCAATGGAGG + Intronic
1119061425 14:71478991-71479013 CCTAAACCTGGAGAAAATGGGGG - Intronic
1121784789 14:96649344-96649366 CCTGCAGCTGCTGCCAATGACGG - Intergenic
1122956424 14:105073626-105073648 CCTAAGCCGGCAGCCAAGGGTGG + Intergenic
1124531556 15:30512471-30512493 CCTATTCCTGCTGCCTATGGTGG - Intergenic
1124767102 15:32495224-32495246 CCTATTCCTGCTGCCTATGGTGG + Intergenic
1127810140 15:62558731-62558753 CCCCAACCTGCTGCCCATAGAGG - Intronic
1129959283 15:79668672-79668694 CCTAAAAATGCTGCGTATGGTGG - Intergenic
1136061426 16:27729280-27729302 CATGAACCTGATGCCATTGGGGG - Intronic
1140535860 16:75709079-75709101 CCTAAAGCTGCTGGCAAAGAAGG - Intronic
1140754994 16:78059016-78059038 CTTAAACGAGCTGCCAAGGGAGG + Intronic
1141036860 16:80634009-80634031 CCTATATCTGCTTCCGATGGAGG - Intronic
1141871295 16:86788535-86788557 CCCAAACGTGCTGACATTGGGGG - Intergenic
1142556656 17:782752-782774 CCTTAACCTCCTTCCGATGGAGG + Intronic
1143484291 17:7244561-7244583 TCTCAACCTGCTCCCAATGCTGG - Exonic
1145865344 17:28237706-28237728 CTTAAACGAGCTGCCAAGGGAGG + Intergenic
1147946274 17:44082025-44082047 CCAAACCCTGCTCCTAATGGTGG - Intronic
1147997006 17:44365359-44365381 CCTAAAAATGCTGCGTATGGTGG - Intergenic
1149118766 17:53134727-53134749 CCTTAACCTGTTGCCAAAGGAGG + Intergenic
1151815201 17:76468317-76468339 CCCAACCCTGCTGCCCACGGTGG - Intronic
1155084332 18:22441819-22441841 CCAATACCTGCTACCAATAGGGG + Intergenic
1157555398 18:48610097-48610119 CCTACACCTGCTTCCATTGCAGG - Intronic
1159425395 18:68278249-68278271 CCTAAAGCTGCTGGCAAAGAAGG + Intergenic
1159898913 18:74023604-74023626 CCTTCACCTTCTGCCAGTGGTGG + Intergenic
1165364817 19:35358980-35359002 CCTCAACCTGCTGGCCCTGGTGG + Exonic
1165366635 19:35371449-35371471 CCTCAACCTGCTGGCCCTGGTGG + Exonic
925639326 2:5972129-5972151 CCTAAACCATCTGGCAGTGGGGG + Intergenic
932134136 2:69213886-69213908 CCCAAGGCTGCTGGCAATGGGGG - Intronic
932352999 2:71046892-71046914 CATAAACCAGCTGCCAAGGGAGG - Intergenic
932364300 2:71138318-71138340 CCTATTTCTGCTGCCTATGGTGG - Intronic
932594758 2:73087014-73087036 CCTAAACCTGTTGCCCAGAGGGG - Intronic
937410119 2:121667738-121667760 CCTTACCCTTCTGCCACTGGTGG - Intergenic
937625064 2:124034795-124034817 CCTGAATCTCCTGCAAATGGTGG - Intronic
938822733 2:134975657-134975679 CCTGAAGCTGCTGCCACTGACGG - Intronic
944377124 2:199058566-199058588 CCTGAACCTTCTTCTAATGGTGG + Intergenic
947594494 2:231402315-231402337 CTTAAACAAGCTGCCAAGGGAGG - Intergenic
948155452 2:235777700-235777722 CCTAGTCCTTATGCCAATGGCGG - Intronic
1172147228 20:32764957-32764979 CATGGACCTGCTGCCAGTGGGGG + Intronic
1173195819 20:40911966-40911988 CCTAAACAGGTTGCCAATGGTGG - Intergenic
1173972097 20:47161077-47161099 CCAAAAGCTGCTGCTGATGGCGG - Intronic
1176060088 20:63168731-63168753 CCAAAACCTGCTGCCCAGAGGGG + Intergenic
1176170167 20:63693165-63693187 CCTCAAACTGCTGCTTATGGTGG - Exonic
1179015857 21:37594115-37594137 CCTTCAGCTGCTGGCAATGGAGG + Intergenic
1179566583 21:42252813-42252835 CCTAAACCTGCTGCCAATGGGGG - Intronic
1179640897 21:42746615-42746637 CCTAACCCTGCTGCCTCTGAGGG - Intronic
1179824072 21:43954249-43954271 CCTCTGCCTGCTGCCATTGGAGG + Intronic
1183179326 22:36248004-36248026 CATACAACTGCTGCCCATGGTGG + Intergenic
1185303813 22:50100919-50100941 TCTACTCCTGCTGCCTATGGTGG + Intronic
949408771 3:3741631-3741653 CTGAAACCATCTGCCAATGGAGG + Intronic
949882131 3:8670135-8670157 CATAAACGAGCTGCCAAGGGAGG - Intronic
950858768 3:16129003-16129025 CCAATATCTGTTGCCAATGGTGG + Intergenic
953173083 3:40525095-40525117 CCTGAACTTGGTCCCAATGGCGG + Exonic
961271771 3:125694864-125694886 CGTAAACGAGCTGCCAAGGGAGG - Intergenic
961530779 3:127538826-127538848 CCTAAACCTTTTTCCATTGGGGG - Intergenic
962183399 3:133232421-133232443 CCTCAAGCTGCTTCCACTGGTGG - Intronic
966323519 3:178728613-178728635 CCTAGACCTGAGGCTAATGGAGG - Intronic
968503052 4:960092-960114 CCCACACCTGCTGCCCAGGGCGG + Exonic
968582197 4:1400385-1400407 CCCAAACCTGGTGGAAATGGGGG + Intergenic
972787161 4:42337060-42337082 CCTACACTTGGCGCCAATGGTGG - Intergenic
978595649 4:110374412-110374434 CCCAAACTTGCTGCCAAAGATGG + Intronic
984381141 4:178995101-178995123 TCTAACCCTGCTGCCGATGCTGG + Intergenic
986707268 5:10462331-10462353 CCTAAACCTTCTGCCAAACACGG - Intronic
988641095 5:33041417-33041439 CTTAGACTTGCTGACAATGGTGG - Intergenic
988695376 5:33616497-33616519 CTTTAACCTGCTGGCAAGGGGGG - Intronic
989421030 5:41240325-41240347 CCTAAACCTGCTACCACCAGTGG - Intronic
991687626 5:69196275-69196297 CCTAAACCCACTGCAAATTGAGG - Intronic
994235715 5:97359449-97359471 TCTCAACATGCTGCCAATGCTGG + Intergenic
994495080 5:100501851-100501873 TCTCAATCTGCTGCCAAAGGGGG - Intergenic
998902206 5:146868248-146868270 CCAAAAGCTGCTGCAGATGGAGG - Intronic
998903267 5:146878065-146878087 AGTAAGCCTGCTGTCAATGGAGG - Exonic
1001725867 5:173899468-173899490 GCTCAACCTGGTGCCAATAGTGG + Intronic
1010041916 6:71395030-71395052 TCTAAACCTTCTTTCAATGGAGG + Intergenic
1012962607 6:105638376-105638398 CCTCAACCTGTTCCCTATGGAGG + Intergenic
1013009018 6:106103436-106103458 CCCAAACCTGCTGCCTCTGAAGG + Intronic
1015134526 6:129852694-129852716 TGTTAACCTGCTGCTAATGGGGG - Intronic
1016059443 6:139614461-139614483 CCTAAAGCTGCTGGCAAAGAAGG - Intergenic
1017829524 6:158113477-158113499 CTTAATCATGCTGCCAATGTAGG + Exonic
1020323556 7:6957614-6957636 CTTAAACGAGCTGCCAAGGGAGG + Intergenic
1022434510 7:30368871-30368893 CCTAAACATTCTGGCAAGGGGGG - Intronic
1022898505 7:34777425-34777447 CCACACCCTGCTGCCATTGGTGG + Intronic
1023922504 7:44640417-44640439 CCTATCCCTGCTGCTATTGGTGG + Intronic
1024632286 7:51259767-51259789 CCTAAAAATGCTGCCCATAGTGG - Intronic
1032650029 7:133868225-133868247 CCTAAACATACTGACATTGGAGG - Intronic
1033742336 7:144284667-144284689 CCTGAACCTAGGGCCAATGGAGG + Intergenic
1033751566 7:144364947-144364969 CCTGAACCTAGGGCCAATGGAGG - Exonic
1036372507 8:8173369-8173391 CTTAAACGAGCTGCCAAGGGAGG - Intergenic
1036817116 8:11910496-11910518 CTTAAACGAGCTGCCAAGGGAGG + Intergenic
1036817454 8:11912807-11912829 CATAAACGAGCTGCCAAGGGAGG + Intergenic
1036820418 8:11935387-11935409 CTTAAACGAGCTGCCAAGGGAGG + Intergenic
1036878396 8:12492272-12492294 CTTAAACGAGCTGCCAAGGGAGG + Intergenic
1037508846 8:19561552-19561574 CTTATACCTGCTGCTAAAGGCGG + Intronic
1038798619 8:30730173-30730195 CTTAAACGAGCTGCCAAGGGAGG - Intergenic
1041151951 8:54944241-54944263 CCTCCACCTTCTGCCACTGGAGG - Intergenic
1043015173 8:74930611-74930633 CCTAAAGCTGTTGTCCATGGGGG - Intergenic
1043481703 8:80659627-80659649 GCTGAAGCTGCTGCCATTGGGGG + Exonic
1050525571 9:6543521-6543543 CCTAAACCTCTTGGCTATGGTGG - Intronic
1051273488 9:15377189-15377211 CCTAAACCTGATGCCAGAGCAGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1056681093 9:88719921-88719943 TCTAAACCTGCTTCCTAAGGAGG - Intergenic
1059287606 9:113188563-113188585 CCTAAACCTGCTTCCAACACAGG + Intronic
1062224671 9:135443006-135443028 CTTAAACGAGCTGCCAAGGGAGG + Intergenic
1186474808 X:9849131-9849153 CCTACACCATCTGCCAAAGGAGG - Intronic
1194400045 X:93431271-93431293 CTTAAACCAGCTGCCAAGGGAGG - Intergenic
1200947869 Y:8864344-8864366 CTTAAACGAGCTGCCAATGTAGG - Intergenic
1201411765 Y:13705395-13705417 CAAAGACCTGCTGACAATGGAGG + Exonic
1201416587 Y:13753355-13753377 CTTAAACCTGCTGGCAAAGCTGG + Intergenic