ID: 1179570042

View in Genome Browser
Species Human (GRCh38)
Location 21:42273289-42273311
Sequence CCTTGGTTCTGCAGGGAGAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 245}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179570034_1179570042 -1 Left 1179570034 21:42273267-42273289 CCCGGCTGACGGCTTCTCCTGTC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG 0: 1
1: 0
2: 1
3: 22
4: 245
1179570030_1179570042 24 Left 1179570030 21:42273242-42273264 CCGGGAGGTGGAGGAGGAGCAGG 0: 1
1: 3
2: 48
3: 280
4: 1355
Right 1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG 0: 1
1: 0
2: 1
3: 22
4: 245
1179570028_1179570042 26 Left 1179570028 21:42273240-42273262 CCCCGGGAGGTGGAGGAGGAGCA 0: 1
1: 0
2: 4
3: 64
4: 530
Right 1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG 0: 1
1: 0
2: 1
3: 22
4: 245
1179570026_1179570042 30 Left 1179570026 21:42273236-42273258 CCTGCCCCGGGAGGTGGAGGAGG 0: 1
1: 0
2: 6
3: 100
4: 658
Right 1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG 0: 1
1: 0
2: 1
3: 22
4: 245
1179570035_1179570042 -2 Left 1179570035 21:42273268-42273290 CCGGCTGACGGCTTCTCCTGTCC 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG 0: 1
1: 0
2: 1
3: 22
4: 245
1179570029_1179570042 25 Left 1179570029 21:42273241-42273263 CCCGGGAGGTGGAGGAGGAGCAG 0: 1
1: 1
2: 29
3: 237
4: 1485
Right 1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG 0: 1
1: 0
2: 1
3: 22
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179570042 Original CRISPR CCTTGGTTCTGCAGGGAGAC GGG Exonic
900360967 1:2288915-2288937 CCTTGGGCCTGCTGGGTGACAGG + Intronic
900561177 1:3307753-3307775 CCCTGTTTCTGCAGGGATCCTGG + Intronic
901220000 1:7578337-7578359 CCTGGGTCCTCCAGGGAGCCGGG + Intronic
901844803 1:11975082-11975104 CCTTGGTTTTTCAGGAAGACAGG - Exonic
903003031 1:20279846-20279868 GCTCGGTCCTGCAGGGAGGCAGG + Intergenic
905262555 1:36729919-36729941 CTGTGGTTCTCCAGGGAGCCAGG - Intergenic
905276252 1:36819965-36819987 TCATGGTTCTGCTGGGAGGCAGG + Intronic
905643996 1:39611835-39611857 CCTTGGTAATGCAGGCACACGGG - Intergenic
906348171 1:45034256-45034278 CCATGGTTGGGCAGGCAGACGGG + Intronic
907340394 1:53731282-53731304 CCCTAGTTCTGCAGGGGGAGAGG + Intronic
908484586 1:64577984-64578006 CCTTGGGATTGCAGGGTGACTGG - Intronic
910457457 1:87412597-87412619 CCTTGGTCCTGAAGGGAGGAGGG + Intergenic
911273479 1:95831837-95831859 CCATGTCTCTGCAAGGAGACTGG - Intergenic
913482184 1:119299358-119299380 TCATGATTCTGCAGGGTGACTGG - Intergenic
914347015 1:146808621-146808643 GCTTGGCTCTGAAGGGAGATGGG + Intergenic
915110236 1:153559818-153559840 TTATGGTTCTGCAGGTAGACTGG - Intergenic
916169166 1:161987750-161987772 CCTTATTTCTGCAGGAAGAGGGG + Intronic
918299023 1:183185741-183185763 CCTTGGTTCAGCCTGGAGAAAGG + Intergenic
920217153 1:204368976-204368998 CCTGGGTTCTGCAGAGTGGCAGG + Intronic
920913268 1:210237018-210237040 CCTTGGGCCTGCAGGGAGATGGG - Intronic
1062806089 10:420481-420503 TGTTGGTTCTGCAGGAAGTCGGG - Intronic
1062966304 10:1610202-1610224 CCCTGGGGCTGCAGGGAGGCAGG - Intronic
1064113755 10:12560160-12560182 GCTTTGTTCTGAAGGGAGGCTGG + Intronic
1064456032 10:15488242-15488264 CCTGGGTTCTGCAGTTAGATGGG + Intergenic
1064877373 10:20009638-20009660 CCTTTGTTCTGTAGAGAGGCAGG + Intronic
1065121820 10:22537973-22537995 CCGTGCTTCTGCAGGGGGCCAGG - Intronic
1067021413 10:42802230-42802252 GCTGGGTTCTTCAGGAAGACTGG + Intronic
1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG + Intronic
1069863118 10:71483500-71483522 CCTGGGTTCTTGAGGGAGGCTGG - Intronic
1070543606 10:77435437-77435459 CCTTTGTTCAAAAGGGAGACAGG + Intronic
1070717281 10:78731923-78731945 CTGTGGCTCTGCAGGAAGACAGG + Intergenic
1072032996 10:91539169-91539191 CCCTGGTTTTCCAGGGAAACAGG - Intergenic
1074597330 10:114879660-114879682 CTTTGGTTTTGCAGAGGGACGGG + Intronic
1074759374 10:116654918-116654940 GCTTGAATCTGCAGGGAGCCCGG - Intergenic
1075875116 10:125799691-125799713 GCTTGGCTCTGCAGGCACACAGG + Intronic
1077556157 11:3227123-3227145 CCTGGGTCCTGTGGGGAGACAGG + Intergenic
1080870316 11:36230989-36231011 CCTTATTCCTGCAGGGAGGCGGG - Exonic
1083488201 11:62996548-62996570 CCTTTCTTCTCCAGAGAGACTGG - Intronic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1084710604 11:70841591-70841613 CCTTGGTTCTTCAGGAATTCTGG + Intronic
1085206907 11:74740125-74740147 CCTTTGTCCTGAAGGAAGACAGG - Intergenic
1085695958 11:78704968-78704990 CCCTGGCTCTGCAGGGACAGAGG - Intronic
1089063153 11:115642700-115642722 CCTTGGTTCCCCAGAGAGATGGG + Intergenic
1089955864 11:122570409-122570431 CCTAGGTTCTGCAGGTAGGATGG + Intergenic
1090359284 11:126161350-126161372 CCTGGTTGCTGCAGGGTGACTGG - Intergenic
1091301464 11:134510625-134510647 CCTGGGGGCTGAAGGGAGACTGG + Intergenic
1092123863 12:6062648-6062670 CCTTGTTTCAGCCGGGAGATTGG + Intronic
1092151431 12:6251563-6251585 CCTTGCAGATGCAGGGAGACTGG - Intergenic
1093267111 12:17016493-17016515 CCGTTGTTCTGCAGGCACACGGG - Intergenic
1093840992 12:23900582-23900604 TATTGGTTCTGGAGGGTGACCGG + Intronic
1093907143 12:24706419-24706441 CCTTGATTCTTCTGGCAGACTGG + Intergenic
1094005064 12:25740545-25740567 CCTTGCTTCTGGGTGGAGACTGG + Intergenic
1095557352 12:43523291-43523313 CCGCCGTTCTGCACGGAGACTGG - Intronic
1096843534 12:54392842-54392864 CCTGGGTTCTGGAGGGAAATTGG + Intergenic
1097265200 12:57740315-57740337 TCTTGGTTCTGTAGGGAGGGAGG - Intronic
1098029861 12:66242548-66242570 GCTGGGTTCTCCAGGGAGAAGGG + Intronic
1098228280 12:68347066-68347088 TCTTGGTGCAGTAGGGAGACAGG - Intergenic
1100009522 12:89936845-89936867 GCCTGGTTCTACAGGCAGACAGG + Intergenic
1100784015 12:98059872-98059894 TCATGGTTCTGCAGGCAGGCTGG - Intergenic
1102031242 12:109741312-109741334 CCTTGCTTCTGGAGGGCTACAGG - Intronic
1104139861 12:125977246-125977268 CCTTGGTTCTGCGGGCTGTCTGG + Intergenic
1104377589 12:128278509-128278531 CATCGGTGCCGCAGGGAGACAGG - Intronic
1104820729 12:131675852-131675874 CCTTGCCCCTGCAGGGAGCCAGG + Intergenic
1105728112 13:23185865-23185887 TCTTGGTTCTGAAGGGTGATGGG + Intronic
1106456217 13:29929572-29929594 CCTTGCTTCTGGATGGACACAGG + Intergenic
1106655890 13:31745604-31745626 CACTTGTTCTGCAGGGAGCCGGG - Intronic
1111978105 13:94988681-94988703 GCTTTCTTTTGCAGGGAGACTGG + Intergenic
1113643312 13:111973730-111973752 CCTGGGTTCTCCAGGGACCCCGG - Intergenic
1113878925 13:113611867-113611889 ACTAGGCTCTGCAGGCAGACAGG - Intronic
1113962535 13:114133375-114133397 GCTGGGGTCTGCAGGGGGACTGG - Intergenic
1113962550 13:114133414-114133436 GCTGGGGTCTGCAGGGGGACTGG - Intergenic
1113962739 13:114133850-114133872 GCTGGGGTCTGCAGGGGGACTGG - Intergenic
1114614059 14:24059120-24059142 CCAGGGTCCTGCAGGGAGGCGGG - Exonic
1115771980 14:36673215-36673237 CCTTTGTACTGCAGAAAGACAGG - Intronic
1117529901 14:56650199-56650221 CCATGGTTTGGCAGGAAGACAGG + Intronic
1117737330 14:58780967-58780989 CCTCGGTTCTGAAGGGAAACTGG + Intergenic
1121464575 14:94106692-94106714 TCATGGTTCTGCAGGGAGCATGG + Intronic
1122488203 14:102095599-102095621 CCCTGGTTCTGCTAGGAGACAGG - Intronic
1122608342 14:102963439-102963461 CCTCTGTTCTTCAGGGACACAGG + Intronic
1122773111 14:104105900-104105922 CCTGGGGTCTGCAGGGGGATGGG + Intronic
1123105548 14:105839585-105839607 CCTTGGCTCTGCAGGGTGGCCGG + Intergenic
1125429824 15:39582595-39582617 CCCTGTTTGTGCAGGAAGACAGG + Exonic
1126366369 15:47898823-47898845 ACTTGGTGCTGCAGGGAGGAGGG - Intergenic
1127295401 15:57604598-57604620 CCTTGAAGCTGCAGGGACACTGG + Intronic
1127992536 15:64131407-64131429 CTTTGGTTCTCCAGGGATATTGG + Intronic
1128305159 15:66593456-66593478 CCTTGGTTGTCAAGGGAGAGGGG + Intronic
1128360207 15:66956548-66956570 CTTTAGTTCTGAAGGGAGATGGG + Intergenic
1128417669 15:67461624-67461646 CCTTGGTTCTCAAAGGAAACAGG - Intronic
1129168128 15:73790919-73790941 CCGTGGATGAGCAGGGAGACTGG - Intergenic
1129913344 15:79246034-79246056 TCTTGGTTCTTCAGAGAGCCAGG + Intergenic
1130149507 15:81300362-81300384 CCTTGGGGATGCAGGGAGTCTGG - Exonic
1130553113 15:84904570-84904592 CCTTGGCTCTGCAGACAGGCTGG - Intronic
1130578821 15:85116850-85116872 CCTTGGCTGTGCTGGGAGATAGG - Intronic
1131562274 15:93455071-93455093 GCTAGCTTCTGCAGGGAGGCAGG - Intergenic
1131563229 15:93462360-93462382 CCTTGGTTCTCTTGGGAGCCAGG + Intergenic
1132654323 16:1035549-1035571 CCTGGGTTCTGGAGGGCCACGGG + Intergenic
1132917668 16:2361441-2361463 CGTGTGTTTTGCAGGGAGACTGG + Intergenic
1133037243 16:3040576-3040598 CCTGGGATCGGCAGGGAGCCTGG - Intergenic
1133038434 16:3047039-3047061 CCTGGGGTCTGCAGAGAGATTGG + Intronic
1133307189 16:4817831-4817853 CCCTGGCTCTGCAGGTAGATTGG - Intronic
1133810844 16:9160018-9160040 CCTGGGTGCTGCAAGGAGTCTGG - Intergenic
1134861293 16:17562643-17562665 CCTTGGTGCTGAAGGAACACCGG - Intergenic
1135134076 16:19874886-19874908 CCTTGCTTTTGAAGGGAGCCTGG + Intronic
1135884751 16:26295723-26295745 CCTTGGCTCTGGCGGGAGGCAGG + Intergenic
1136187941 16:28599152-28599174 CCTTGTTTCTGCAGGCACACTGG - Intergenic
1136190413 16:28612146-28612168 CCTTGTTTCTGCAGGCACACTGG - Intronic
1136541512 16:30930058-30930080 TTTGGTTTCTGCAGGGAGACAGG - Exonic
1138489124 16:57366024-57366046 CCTGGGTTCGGGAGGGACACAGG - Exonic
1139632915 16:68241327-68241349 TCTCGGGGCTGCAGGGAGACTGG + Intergenic
1139986969 16:70906649-70906671 GCTTGGCTCTGAAGGGAGATGGG - Intronic
1140335543 16:74101580-74101602 GATTGTTTCTGCAGGGAGATGGG - Intergenic
1141618225 16:85222025-85222047 CCTCGGGTCTGCTGGGAGCCTGG + Intergenic
1141951462 16:87342650-87342672 CGTTCGTTCTGCAGGGGGAGGGG + Intronic
1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG + Intronic
1142984722 17:3688959-3688981 CCCTCGTTCTTCAGGGAGAAGGG + Intronic
1143252817 17:5535588-5535610 GCTTAGTCCAGCAGGGAGACAGG - Intronic
1143609486 17:8009492-8009514 CCTCTTTGCTGCAGGGAGACAGG + Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG + Intergenic
1144656365 17:17039800-17039822 CCTAGCCTCTTCAGGGAGACAGG - Intergenic
1146549947 17:33771636-33771658 GCTGGGTTTTGCAGTGAGACAGG - Intronic
1146832399 17:36081508-36081530 CCTGGGGTCTGCAGGGAACCAGG - Intergenic
1147312764 17:39605097-39605119 CCTTGGGCCTGCAGGGAGGAGGG + Exonic
1147405653 17:40210066-40210088 CTTAGGTTCTGCAGACAGACAGG + Intergenic
1147677686 17:42219178-42219200 TCTTGTTTCTCCAGGGAGCCTGG - Intronic
1147688351 17:42300393-42300415 TCTTGTTTCTCCAGGGAGCCTGG + Intronic
1148126052 17:45237531-45237553 CCTTGGTTCTGGAGAGAGAAGGG - Exonic
1149003695 17:51782759-51782781 TCCTGGTTCAGCAGGGAGGCAGG + Intronic
1149309785 17:55382771-55382793 CCTTGGTTATGAAGGGAAAGAGG - Intergenic
1150280689 17:63928298-63928320 CCTTGGTTCTCCAGGCAAACTGG - Intergenic
1150741895 17:67785819-67785841 CCTAGGTTTTCCAGGGACACTGG + Intergenic
1151408064 17:73902289-73902311 CCTGGGTTCTGCAGGGACTGAGG + Intergenic
1151554594 17:74840337-74840359 CCTTGGTGGTGCAGGAAGCCAGG + Intergenic
1151802502 17:76386206-76386228 CCGCCGCTCTGCAGGGAGACCGG - Exonic
1152228952 17:79105236-79105258 CCTCCGTTCTGCAGGGACCCAGG + Intronic
1152315004 17:79575078-79575100 CCTAGGTTCTGAAGGCAGCCTGG + Intergenic
1152466738 17:80470911-80470933 CCTTGGTGCTGCAGGTGGCCAGG + Exonic
1153480765 18:5543912-5543934 CCTGGGATCAGCAGGGAGCCCGG + Exonic
1156703738 18:39855388-39855410 CCTTGCCTCTGCAGTGAGCCAGG - Intergenic
1157568854 18:48699011-48699033 CCTTGGTGCTGGAGGGACAGAGG - Intronic
1158591833 18:58784871-58784893 CCTTGGTTCCGGAGGGGGAGGGG - Intergenic
1158936697 18:62371165-62371187 CCTTGGTTGTGGAGACAGACAGG + Intronic
1160240585 18:77119719-77119741 CCTTGATTCTGGAGGGACAAGGG + Intronic
1160351456 18:78184499-78184521 CCTTGGGTCTGCAGTGAGTCTGG + Intergenic
1160696982 19:489516-489538 CCTCGGCTCTGCAGGGAGGACGG - Intronic
1163843293 19:19624704-19624726 CCCTGATTCTGCAGTGTGACAGG + Intronic
1166201263 19:41239198-41239220 CCCTGGAGCTGCAGGGGGACGGG + Exonic
1167098896 19:47391840-47391862 CCTTTGTTCTGCAGAGGGAGGGG + Intergenic
1167452503 19:49580433-49580455 CCTGGGGTCTTGAGGGAGACTGG - Intronic
926228975 2:10988631-10988653 CCTTGTTTCTGCAGTGGGTCTGG - Intergenic
927053632 2:19351636-19351658 CCTGGGGTCTGCAGGGGGCCCGG - Exonic
927408106 2:22795518-22795540 CCGTGGTTCTGCAGGGACCTGGG - Intergenic
929121946 2:38490554-38490576 CCTGGGTTCTCCAGGATGACTGG + Intergenic
929879547 2:45823991-45824013 CCTTGGCACTGCAGGGAGGTTGG + Intronic
930269614 2:49241022-49241044 CTTTGGTGCTGAAGGGAGAAGGG + Intergenic
931825136 2:65992443-65992465 CCCAGGTTCTGAAGAGAGACAGG - Intergenic
932926886 2:75986789-75986811 CAATGGTAGTGCAGGGAGACTGG + Intergenic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
936049671 2:109213482-109213504 CCCAGGATCTGCAGGGAGCCTGG + Intronic
936777002 2:115985981-115986003 CCCTGGATGTGCAGGCAGACTGG - Intergenic
939515097 2:143156477-143156499 ACATGTTTCTGCAGGGTGACTGG - Intronic
941887456 2:170543132-170543154 CTTTGGTTCAGTAGAGAGACAGG + Intronic
942091460 2:172495604-172495626 CCGTGGTTCTGGAGGGCGAGAGG - Intronic
944153985 2:196592625-196592647 GTTTGGTTCTCCAGGGAAACTGG - Intronic
944615031 2:201451519-201451541 CCTCGGTTCTGCGGCGACACCGG + Exonic
946404809 2:219486672-219486694 CCTTGTTTCTGCAGGGAACGGGG - Intronic
948591655 2:239054336-239054358 CCTTGGCCCTGCAGAGAGGCAGG - Intronic
948764490 2:240212470-240212492 CCTTGGTCCTGCAGGGAGGCTGG + Intergenic
1169531481 20:6489775-6489797 CATTGGTTTTTCAGGGAGAGAGG - Intergenic
1173222774 20:41143048-41143070 TGCTGGTTTTGCAGGGAGACAGG + Intronic
1174796544 20:53527344-53527366 CCTTGGTGCTGCAGGAAGCCAGG - Intergenic
1175863908 20:62164389-62164411 CCTTGCTCCTGCAGGGCGTCTGG - Intronic
1179244903 21:39624484-39624506 GCTTGGTTTTGTAGGGAGTCTGG + Intronic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1180757096 22:18169687-18169709 CCATGGTTCTGCAGGCCAACCGG - Intronic
1181074682 22:20367778-20367800 CCATGGTTCTGCAGGCCGACCGG + Intronic
1181487685 22:23241821-23241843 CCTAGAGGCTGCAGGGAGACAGG - Intronic
1181675003 22:24445600-24445622 CCTTGGCTCTGCAGCCTGACAGG - Intergenic
1182830811 22:33303291-33303313 ACTTGGCTCTGCAGCCAGACTGG + Intronic
1182984468 22:34703260-34703282 CCTCGGGTCTGCAGGGACTCAGG - Intergenic
1183326876 22:37199183-37199205 CCTTCGTTTTGCAGGGAGAAAGG - Intronic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
1184161004 22:42697382-42697404 TCTTTCTTCTGCAGGGAGAGGGG + Intronic
1184458088 22:44622716-44622738 CCTTGGCCCTGCACAGAGACAGG + Intergenic
1184992837 22:48182254-48182276 CCTTGGCTCTGTAGGGAGAGAGG - Intergenic
1185275232 22:49947804-49947826 CCTAAGTGCTGCCGGGAGACAGG + Intergenic
950465355 3:13150000-13150022 CCCTGGTTCTAGAGGGAGAGTGG + Intergenic
950878482 3:16301060-16301082 TCTTGTTTCTCTAGGGAGACAGG + Intronic
951659350 3:25045336-25045358 CTGGGGTTCTGCAGTGAGACAGG + Intergenic
952733475 3:36664679-36664701 TCATGGTTCTGCAGGCTGACAGG - Intergenic
953028418 3:39159259-39159281 CCTTGGTTGTGCAGAGGGAAGGG + Intergenic
953699895 3:45187421-45187443 CCCAGGGTCTGCAGGGAGGCAGG + Intergenic
953890568 3:46749281-46749303 CCTTGGTTCTGCAGAGCCTCTGG - Intronic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
954716763 3:52530856-52530878 CCCTGCTTCTGGAGGGACACTGG - Intronic
954866237 3:53732310-53732332 CCCAGCTTCTGCTGGGAGACTGG + Intronic
955857104 3:63284528-63284550 CCTTGGTTAGGCAGGGAGGTAGG - Intronic
961191857 3:124968805-124968827 CATTGGTTCTACAGAGAGAGAGG + Exonic
961417761 3:126773384-126773406 CCTTGGTTCCACAGGGAGCACGG - Intronic
961458659 3:127036726-127036748 CCCTGTGTCTGCAGGGAGCCAGG + Exonic
961713832 3:128845904-128845926 CCTCGGGTCTCCATGGAGACAGG + Intergenic
963081945 3:141402548-141402570 CCTCGCTTCTGGAGGGAGCCGGG + Intronic
968076361 3:195817774-195817796 CCATGGTTCAGCAGGGAGGCGGG + Intergenic
970912576 4:21294331-21294353 CTTTGGTTCAGCAGGGAGTTAGG - Intronic
972458204 4:39274715-39274737 CCCTGGTTCTGTAGGAAAACAGG - Intronic
976615094 4:87068525-87068547 TCCTGGTTTTGCAGGGAGACGGG + Intronic
977301557 4:95273550-95273572 TCTTGCTTCTTCAGGGAGATGGG + Intronic
977528081 4:98167979-98168001 CCTTGGTGTGGCAGGGAGAGGGG + Intergenic
984185309 4:176536460-176536482 TCTGGGTTCTGCAGGGTTACAGG - Intergenic
985811729 5:2094969-2094991 CTTTGGTTTTGCAGGAAGCCGGG - Intergenic
987759436 5:22141448-22141470 CCTTAGTTCTTTAGTGAGACTGG + Intronic
991894158 5:71374878-71374900 CCTTAGTTCTTTAGTGAGACTGG + Intergenic
991970964 5:72141239-72141261 CCTTTGCTCTGCAGAGACACTGG + Intronic
992784085 5:80153835-80153857 TAGTGGTTCTGCAGGGAAACAGG - Intronic
993641854 5:90415617-90415639 CCTTGGTTCTGAAAAGAGAATGG - Intergenic
997420828 5:133765542-133765564 CCTGGGCTCTGCAGGGGCACAGG - Intergenic
997725716 5:136118359-136118381 TCCTGGTTCTGCTGGGAGATTGG - Intergenic
998584225 5:143409168-143409190 CCATTGTTTTCCAGGGAGACTGG + Intronic
998852648 5:146365425-146365447 ACTTGATACTGCAGGGAGATGGG + Intergenic
1000572328 5:162930151-162930173 TCTTGTTTCTACAGGGGGACTGG + Intergenic
1004275098 6:14229207-14229229 CCTTGGTCCTGCAGGATGAGTGG + Intergenic
1008363529 6:50649597-50649619 CCTTGGCTATACAAGGAGACTGG + Intergenic
1013343187 6:109235664-109235686 CCTTGGTACTATAGGGAGGCTGG + Intergenic
1019128670 6:169858477-169858499 CCTGGGTTGTGGAGGGAGCCTGG + Intergenic
1019929515 7:4214555-4214577 CCTTGGCTCTGCAGGCTGAGGGG + Intronic
1020509001 7:9028895-9028917 ACTTAGTTCTGCAGGGAGGATGG + Intergenic
1022725858 7:32980978-32981000 AGATGGTTCTGCAGGAAGACAGG + Intronic
1023136022 7:37052840-37052862 CCTTGGTGCTGAACGGAGGCTGG - Intronic
1023140164 7:37094207-37094229 CCTGGTTTCTGCATTGAGACTGG - Intronic
1023233371 7:38057668-38057690 CCTCGATTCTGCAGGGAGAGAGG + Intergenic
1023866458 7:44240679-44240701 CCTTTCTTCTCCAGGGAGACAGG - Intronic
1025047740 7:55706671-55706693 AGATGGTTCTGCAGGAAGACAGG - Intergenic
1027406308 7:77865085-77865107 AATTGTTTCTGCATGGAGACAGG + Intronic
1028351732 7:89857870-89857892 CCTGAGATCTGCAGGGAGCCAGG + Intergenic
1029688750 7:102166398-102166420 CCCTGTCTCTGCAGGGACACAGG + Intronic
1030086751 7:105822314-105822336 CCTTGGAGCTGTAGGGAGAAAGG + Intronic
1031976920 7:128099964-128099986 GGTTGGTTCTGAAGGCAGACGGG + Intergenic
1032326632 7:130935146-130935168 TCTTGAGTCTGAAGGGAGACTGG + Intergenic
1032448463 7:132004705-132004727 ATTTGCTTCTACAGGGAGACAGG + Intergenic
1034189709 7:149204583-149204605 CCTTGGATTTGCAAGGAGAGGGG + Intronic
1036645986 8:10611662-10611684 CCTTGGTTCTGCAGGTTGGACGG - Exonic
1039854768 8:41402752-41402774 GCTTGGTTCTCTAGGGAGAAAGG - Intergenic
1039893457 8:41699666-41699688 TCTTGATGCTGCAAGGAGACTGG + Intronic
1039966267 8:42286370-42286392 CCTTGTTCCTGCAGGGATCCTGG + Intronic
1040520494 8:48172338-48172360 CCTGAGTTCTGCGAGGAGACAGG + Intergenic
1043309740 8:78843437-78843459 CCATGGTTCAGCAGAGTGACAGG + Intergenic
1044812404 8:96077126-96077148 CCCAGCTTCTGCAGGGATACTGG + Intergenic
1051078951 9:13274353-13274375 CCTTGGATCTGGAGGCAGAGTGG + Intronic
1051193877 9:14542448-14542470 CCTTGGTGATGCAGGGAGATGGG - Intergenic
1052026228 9:23576520-23576542 TCTAGGGGCTGCAGGGAGACAGG - Intergenic
1052810543 9:33054912-33054934 CCTTAGTTCTGCAGTGAGTGGGG - Intronic
1053304136 9:36972191-36972213 CCTGGGTTCTGCAGAGAAACTGG - Intronic
1055581963 9:77715330-77715352 CCCTAGTTCTGCAGAGACACTGG - Intergenic
1057091157 9:92259257-92259279 CATTGGTCCTGCAGTGAGAGTGG - Intronic
1057178762 9:93017996-93018018 CCACAGTTCTGCAGGGAGAGGGG - Intronic
1058102410 9:100931874-100931896 TCTTGCTTCTCCAGGGAGAGTGG - Intergenic
1060996784 9:127878503-127878525 CCAGCGTTTTGCAGGGAGACTGG + Intergenic
1061601762 9:131674988-131675010 CCTGGGATGTGCAGGGACACTGG + Intronic
1061715929 9:132518858-132518880 CCTTGGCACTGCAGGGCGATAGG + Intronic
1186999644 X:15162506-15162528 CCTTATTTCTACAGGGATACAGG + Intergenic
1191105384 X:56769055-56769077 CCATGGAGCTGCAGGGAGTCGGG + Intergenic
1191106377 X:56774457-56774479 CCATGGAGCTGCAGGGAGTCGGG + Intergenic
1191107370 X:56779859-56779881 CCATGGAGCTGCAGGGAGTCGGG + Intergenic
1191841135 X:65514232-65514254 CCTTGGGTCACCAGGGAGCCAGG - Intronic
1192591536 X:72363986-72364008 CCTTGGTTCAACAGGGAAGCAGG + Intronic
1192798120 X:74441608-74441630 ACATGGTCCTTCAGGGAGACAGG - Intronic
1193671934 X:84397567-84397589 GCTGGGTTCTGCCTGGAGACTGG - Intronic
1194583751 X:95707989-95708011 CCTTAGGTCTCCAGGGAGAATGG - Intergenic
1195023152 X:100849395-100849417 TACTGGATCTGCAGGGAGACAGG - Exonic