ID: 1179571149

View in Genome Browser
Species Human (GRCh38)
Location 21:42279576-42279598
Sequence TGAACTGGATGGTTTCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179571141_1179571149 6 Left 1179571141 21:42279547-42279569 CCCCACCTGCCTTTTGGGGCAGT 0: 1
1: 0
2: 0
3: 23
4: 209
Right 1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 200
1179571142_1179571149 5 Left 1179571142 21:42279548-42279570 CCCACCTGCCTTTTGGGGCAGTG 0: 1
1: 0
2: 1
3: 20
4: 151
Right 1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 200
1179571143_1179571149 4 Left 1179571143 21:42279549-42279571 CCACCTGCCTTTTGGGGCAGTGC 0: 1
1: 0
2: 3
3: 19
4: 192
Right 1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 200
1179571145_1179571149 -3 Left 1179571145 21:42279556-42279578 CCTTTTGGGGCAGTGCAACCTGA 0: 1
1: 0
2: 0
3: 13
4: 82
Right 1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 200
1179571138_1179571149 11 Left 1179571138 21:42279542-42279564 CCAGGCCCCACCTGCCTTTTGGG 0: 1
1: 0
2: 1
3: 41
4: 414
Right 1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 200
1179571144_1179571149 1 Left 1179571144 21:42279552-42279574 CCTGCCTTTTGGGGCAGTGCAAC 0: 1
1: 0
2: 0
3: 8
4: 79
Right 1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG 0: 1
1: 0
2: 0
3: 8
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179571149 Original CRISPR TGAACTGGATGGTTTCTTTA AGG Intronic
905154945 1:35969085-35969107 TGAACTGGGTTGTTTGTTTTGGG + Intronic
908587102 1:65581810-65581832 TGAACTGAATGATATATTTAAGG - Intronic
910140261 1:84019344-84019366 TGAACTGGATAGGTTCCTAATGG - Intergenic
910454309 1:87380009-87380031 AGAACTGGATCATTTCTGTAGGG - Intergenic
911109636 1:94168935-94168957 TGAACTGCATGCTTATTTTATGG + Intronic
911284744 1:95975533-95975555 TGAATTGGATAGGTTCTTCATGG - Intergenic
911964950 1:104355348-104355370 TGAGCTTCATTGTTTCTTTATGG + Intergenic
913113317 1:115675267-115675289 TGAAATGGATGGATCCCTTAAGG + Intronic
915249276 1:154576929-154576951 TGAACTGACTGGTTACTCTAAGG + Exonic
915583891 1:156833010-156833032 TGAGCAGGATGGTGTCTGTATGG - Intronic
915621825 1:157090913-157090935 GGAACTGGATGGTTTTGTCATGG - Intergenic
916874871 1:168958524-168958546 TGAAATGGATGGTTTCATGCAGG + Intergenic
917404274 1:174686524-174686546 TGACATGGATGTTTTCTTCAAGG + Intronic
919675696 1:200380538-200380560 CCACCTGGCTGGTTTCTTTAGGG - Intergenic
919703514 1:200654992-200655014 TGAAACGTATGGTTTCTCTAAGG - Intronic
920826683 1:209429387-209429409 TGAACTGGGTGCTTTATATAGGG + Intergenic
924605720 1:245533089-245533111 TGGACCGGATGGTTTTTCTAGGG + Intronic
1063198071 10:3761449-3761471 AGAACTGCATGGTTTTCTTACGG - Intergenic
1064620205 10:17207760-17207782 TGAACTTCATGATGTCTTTAAGG + Intergenic
1065329963 10:24585582-24585604 TGGACTGGTTGATTTCTTCATGG + Exonic
1067049330 10:43003013-43003035 TGGATTGGAAGCTTTCTTTAGGG - Intergenic
1068181956 10:53532804-53532826 GGGACTGTATGTTTTCTTTAGGG - Intergenic
1068425940 10:56864261-56864283 TGAATTTGATTTTTTCTTTAAGG + Intergenic
1069725435 10:70574590-70574612 TGAGCTGGATGGATTATTTGAGG - Intergenic
1070479648 10:76869914-76869936 TGCACTTCAAGGTTTCTTTAGGG - Intronic
1071405811 10:85330427-85330449 TTAACTGGAAAGTTTGTTTAAGG + Intergenic
1071490587 10:86133910-86133932 TAAACTGTTTGTTTTCTTTATGG - Intronic
1073327821 10:102652382-102652404 TGAACTGGAGGGTTACTTTGAGG + Intronic
1073416267 10:103385528-103385550 TGAACAGAATGGTTTCTTGTTGG + Intronic
1074677491 10:115868614-115868636 CGAACTGCATGCCTTCTTTAGGG - Intronic
1074929419 10:118108472-118108494 AGAAGGGAATGGTTTCTTTAAGG + Intergenic
1080043075 11:27779634-27779656 TAAAGTCGGTGGTTTCTTTAAGG + Intergenic
1081990262 11:47333653-47333675 TGAACAGGATGGTGTCTGTGGGG + Exonic
1082099776 11:48162854-48162876 TGAAATGGATGGTTTTTTGGGGG + Intronic
1082269609 11:50155765-50155787 TGAACAGGATGTTTTCCTGAAGG + Intergenic
1084747246 11:71180932-71180954 GGAAGTGGAAGGTTGCTTTATGG - Intronic
1084896382 11:72273317-72273339 TGAACTTGGGGGTTTCTTTTTGG - Intergenic
1085374893 11:76051487-76051509 AAAACTGGAAGGTTTCTATAAGG + Intronic
1086313162 11:85559103-85559125 TGAACTAAATGGATTCTTTTTGG - Intronic
1088804097 11:113335328-113335350 TGATCTGCATGGTTACTTTTGGG - Intronic
1089552956 11:119295234-119295256 TGTTCTTGATGGTTTCCTTAGGG + Intronic
1093722131 12:22455992-22456014 TTAGATGGATGTTTTCTTTAAGG - Intronic
1095525198 12:43117114-43117136 TGAACTGGATTCCTTCTTTGAGG + Intergenic
1095707621 12:45254492-45254514 AGCACTGGATGGTTTGTTGAAGG + Intronic
1096114528 12:49047771-49047793 TGGACTTGATAGTTTCTTTGTGG - Intronic
1097859195 12:64501091-64501113 AGAACTGGATAATTTCTTTCTGG - Intronic
1097957748 12:65503986-65504008 GCAACTGGTTGGTTTCCTTAAGG + Intergenic
1098007516 12:66014112-66014134 TAAACTAGATGGATTATTTATGG - Intergenic
1099246690 12:80201124-80201146 GGAACTGGATGCTTTCTTCTAGG + Intergenic
1100362210 12:93889404-93889426 TGAATTGAGTGTTTTCTTTAGGG - Intronic
1100963934 12:99991991-99992013 TTTACTGGAGAGTTTCTTTATGG + Intergenic
1101298996 12:103458567-103458589 TGAGCTGGATGTTTTCCATATGG - Intronic
1101625847 12:106440437-106440459 GGAACTGGAAGGCTTCTGTAAGG - Intronic
1106129955 13:26931924-26931946 TGAACTGGAATCTCTCTTTAAGG - Intergenic
1108239858 13:48452318-48452340 TGAGCTTGATGTTTTATTTATGG + Intronic
1109248914 13:59994285-59994307 TAAAATGCATTGTTTCTTTATGG + Intronic
1109287087 13:60422284-60422306 TGAAGTGGTTGGTTTCATTAGGG - Intronic
1110028717 13:70576694-70576716 TGGACTAGAGGGTTTTTTTAGGG - Intergenic
1110201811 13:72859720-72859742 TGACCTGCATGGTTTCAATATGG + Intronic
1112371483 13:98797625-98797647 TGAACTTTGTGGTTTCTTTTTGG - Intronic
1113587708 13:111476555-111476577 GGAACTGGAGGGTTATTTTAGGG + Intergenic
1116073644 14:40082629-40082651 GGAAGTGAATGATTTCTTTAAGG + Intergenic
1117578374 14:57125241-57125263 AGCACTAGATGGTTACTTTACGG + Intergenic
1118119477 14:62822844-62822866 TGCACTGTATGGTTTTTTAAAGG - Intronic
1118817508 14:69323616-69323638 TGAACAGCATGGTTTCTCAAGGG + Intronic
1118942016 14:70347089-70347111 GGAACTGGGTGGACTCTTTAAGG - Intronic
1120468277 14:84889361-84889383 TGAACTGGATGTTTTCCCTTGGG - Intergenic
1125018800 15:34964543-34964565 TGAGCTGTATTGTTTCTCTAGGG - Intronic
1129731447 15:77934854-77934876 TGGCCTCTATGGTTTCTTTAGGG - Intergenic
1131870935 15:96764287-96764309 TAAATTGGATGGATTATTTAAGG - Intergenic
1134777631 16:16866769-16866791 TTAGCTGGATAGTCTCTTTATGG + Intergenic
1135386712 16:22048056-22048078 TGAACTGCAAGGTATCTTCAAGG + Intronic
1139934302 16:70557275-70557297 AGAACTGGATGGGTTCCTGAAGG + Intronic
1143766966 17:9144221-9144243 TGCACTGGATGAGTTCATTATGG - Intronic
1148643088 17:49202808-49202830 AGAACTGGATGGTTGCCTTGAGG - Intronic
1149125201 17:53221222-53221244 TAAACTGGGTTGTTTCTTTTTGG - Intergenic
1150845345 17:68651517-68651539 TGAACTTGATGGTTGTTATATGG + Intergenic
1151708598 17:75786081-75786103 GGAAGTGTATGGTTTCTTTGTGG + Intronic
1152167357 17:78718567-78718589 TGAACACGCTGGTTTGTTTAAGG - Intronic
1153931948 18:9886845-9886867 TGGATTGGATGGTTTCTTCTGGG - Exonic
1153931992 18:9887025-9887047 TGGATTGGATGGTTTCTTCTGGG - Exonic
1153932033 18:9887205-9887227 TGGGCTGGATGGTTTCTTCTGGG - Exonic
1153932119 18:9887520-9887542 TGGGCTGGATGGTTTCTTCTGGG - Exonic
1153932165 18:9887700-9887722 TGGGCTGGATGGTTTCTTCTGGG - Exonic
1156414047 18:36868682-36868704 AATACTGGATGGTTTTTTTAAGG - Intronic
1158902437 18:61977479-61977501 TGAACCTGATGTTTTCTTCATGG + Intergenic
1161229578 19:3166703-3166725 TGCACTGGATCGTTTCTCCAAGG + Intergenic
1162261470 19:9537879-9537901 TGAACAGGATGGTTGGATTAAGG - Intronic
1163595157 19:18217021-18217043 GGACCTGGATGGTTTCTTACAGG - Intronic
1164939533 19:32241846-32241868 GGAACTGCATGGTTTCTTGTAGG - Intergenic
1166031631 19:40135269-40135291 TGATCTGGATGGTATATTTTTGG - Intergenic
925607168 2:5671438-5671460 TGAACCTGTTGATTTCTTTATGG - Intergenic
927249308 2:20983502-20983524 TGAACTGGATGGATTTTTCCAGG - Intergenic
928500501 2:31888778-31888800 TGAAATGCAGGGTTTCTTTTTGG + Intronic
929962812 2:46509131-46509153 TGATCTGGCTCTTTTCTTTAAGG - Intronic
931184245 2:59934378-59934400 TGATCTGCTTGATTTCTTTACGG - Intergenic
933145387 2:78845884-78845906 TGAACAAGATGGTTTCTTGCTGG - Intergenic
939506633 2:143054660-143054682 TAAACTGGAAGGTAGCTTTAGGG - Exonic
942963780 2:181864651-181864673 TCAACTGGAGGGTTTCAGTAGGG - Intergenic
943043314 2:182828670-182828692 TGAGCTGGATGGATTCTGTTGGG - Intergenic
943721625 2:191209058-191209080 TGAACTGGATGGCCTCTTAATGG - Intergenic
944589778 2:201206031-201206053 TCAAAAGGACGGTTTCTTTAGGG + Intronic
944631722 2:201633391-201633413 TGAACTAGATGACTTCTTTTGGG + Exonic
944935750 2:204565786-204565808 TGAACTAACTGGTTTTTTTATGG - Intronic
945070453 2:205983692-205983714 GGATTTAGATGGTTTCTTTAGGG + Intergenic
946924827 2:224616300-224616322 TTTACTTGATGATTTCTTTAGGG + Intergenic
947190228 2:227496820-227496842 TGGTTTGGATGGTTTCTGTAGGG + Intronic
1168893601 20:1309348-1309370 TATACTGGGTGGTTTCTCTAAGG + Intergenic
1169565820 20:6852514-6852536 GGAATTGGCTGGCTTCTTTATGG + Intergenic
1170925529 20:20719572-20719594 TGAACTGGGTGTGTACTTTAAGG + Intergenic
1171823349 20:29874835-29874857 TGAATTGGTTGGTTGCTTTGTGG - Intergenic
1171896753 20:30815477-30815499 TGAATTGGTTGGTTGCTTTGGGG + Intergenic
1173496960 20:43526440-43526462 AGAACTGGAGGGTTTCTTGAGGG + Intronic
1173637385 20:44572417-44572439 TGAACTACATATTTTCTTTAAGG - Intronic
1174407057 20:50309443-50309465 AGAACTGGATGATTTCTCCAGGG - Intergenic
1179571149 21:42279576-42279598 TGAACTGGATGGTTTCTTTAAGG + Intronic
1181083692 22:20429639-20429661 TGCGCTGGTTGGTTTCTGTAGGG + Exonic
1185416524 22:50713501-50713523 TGAAGTGAATGATTTCTTTTTGG - Intergenic
949172355 3:1015901-1015923 TGAAATGGATAATTTATTTAAGG + Intergenic
951034751 3:17920842-17920864 TAAATTTGATGGTTTCTTGAGGG + Intronic
952874938 3:37936718-37936740 TCAACTCTATGATTTCTTTAAGG + Intronic
953765920 3:45742127-45742149 TGAAACGGATGATTCCTTTAGGG + Intronic
956253864 3:67263351-67263373 TGCACTGGCTGTTCTCTTTATGG + Intergenic
956307692 3:67844240-67844262 TAAAGTGGATGGCTTCTCTATGG - Intergenic
956910683 3:73813561-73813583 TGAACAGGATGTTTTCCTGAAGG + Intergenic
958674405 3:97249292-97249314 TGCACTGAATGTTTTATTTATGG + Intronic
958702003 3:97603783-97603805 TGAACAAGATGGTTTCTCTTAGG - Intronic
959675705 3:109033081-109033103 TGAAGTGGATGTATTATTTAAGG - Intronic
960289244 3:115863390-115863412 TGTACTGGATGATATTTTTATGG + Intronic
960740556 3:120828536-120828558 TGAATTTGAAGTTTTCTTTAAGG - Intergenic
962082451 3:132154996-132155018 TAAACTGTAAGGTTTCTTAAAGG + Intronic
962342567 3:134597625-134597647 TGAGCATGATGGTTTCTCTAGGG + Intergenic
966012130 3:175092706-175092728 TGAACTGAATGGTATTTTTCTGG - Intronic
966096372 3:176208602-176208624 TCATCTGGATGGTTTGTTCAAGG + Intergenic
967848548 3:194064083-194064105 TGAAGAGGATAGATTCTTTAAGG + Intergenic
969401036 4:6955686-6955708 TGAAGTGTATGGTATCTTGAGGG + Intronic
970179141 4:13370732-13370754 TGAACTTGTTTGTTTCTGTATGG - Intronic
970492739 4:16591504-16591526 TACGCTGGATGTTTTCTTTAAGG + Intronic
970922162 4:21407292-21407314 TAACCTGGATGGTTTATTTATGG - Intronic
973052200 4:45610110-45610132 GGAACTGGGTGGGCTCTTTAAGG - Intergenic
975482909 4:74901709-74901731 TGAACAGAATTGTTTATTTAAGG - Intergenic
977160043 4:93622621-93622643 TGAATTAAATGCTTTCTTTAGGG + Intronic
978488271 4:109281278-109281300 TGTACTGTATGGTTACTTGATGG - Intronic
981332867 4:143532795-143532817 TTGACTGGATGGTTTCTTTGTGG + Intronic
982541697 4:156680166-156680188 TGAACTGGATGTTTTAATCAGGG + Intergenic
983084790 4:163429505-163429527 TGACATTGATGGTTGCTTTAAGG + Intergenic
984701494 4:182821501-182821523 TGGGTTGGATAGTTTCTTTATGG + Intergenic
985960859 5:3302363-3302385 TGCTCTTGTTGGTTTCTTTAAGG - Intergenic
988038968 5:25863346-25863368 AGAAATTAATGGTTTCTTTAGGG - Intergenic
988556052 5:32237031-32237053 TGAGCAAGATGGTTTCTTTCAGG - Intronic
990969834 5:61493014-61493036 TGAAGTGGATGGATTCATTTAGG + Intronic
993787093 5:92155874-92155896 TCAACTGTATGCTGTCTTTAAGG - Intergenic
996077443 5:119213619-119213641 TAAGCTGGGTGGTTTGTTTATGG - Intronic
998147303 5:139737317-139737339 TGAACTAGCTGGTTTTTTTATGG - Intergenic
1001968490 5:175933758-175933780 TGGACTGGAAGTTTTCTTTGTGG - Intronic
1002248949 5:177910004-177910026 TGGACTGGAAGTTTTCTTTGTGG + Intergenic
1003369376 6:5509734-5509756 GAAAGTGGGTGGTTTCTTTATGG + Intronic
1008338977 6:50341681-50341703 TGAATTAAATGGCTTCTTTAAGG + Intergenic
1010791034 6:80065453-80065475 TGGACTGGTTGATTTCTTCATGG + Intergenic
1011586397 6:88930922-88930944 TTACTTGGATGGTTTCTTTATGG - Intronic
1011716470 6:90110773-90110795 TGAACTGGCTGCTTTTTTCATGG - Intronic
1011867433 6:91847660-91847682 TGAAATGAATGGTTTATATATGG + Intergenic
1012351297 6:98254162-98254184 TGTACTTGATTGTTTGTTTAAGG - Intergenic
1012352965 6:98276296-98276318 TTACATGTATGGTTTCTTTATGG - Intergenic
1013174730 6:107667610-107667632 TAAATTGGATGGTTTCCTTCAGG + Intergenic
1013766885 6:113584830-113584852 ACAACTGGATGTTTTCTTTTAGG - Intergenic
1017297685 6:152817753-152817775 TGATGTGGATGGCTTCCTTAGGG + Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1018716298 6:166535300-166535322 AGAACTGGAGGGTTTCTATTGGG + Intronic
1019727643 7:2611852-2611874 TGAACTGGCTGGTAACTTGATGG + Exonic
1021242372 7:18219296-18219318 TTCACTGGATGTTTTCATTAAGG + Intronic
1022003371 7:26246063-26246085 GGAACTGGGTGGGCTCTTTAAGG - Intergenic
1022250696 7:28604986-28605008 AGAACTTGATGGTTTATATAAGG + Intronic
1022487189 7:30788726-30788748 TGAACTTGCTGGTTTTTTCATGG - Intronic
1022611088 7:31874054-31874076 TGAAATGAATGCTTTCTTTTTGG - Intronic
1023207711 7:37769014-37769036 TTTACTGCATGGATTCTTTATGG - Intronic
1027161624 7:75806811-75806833 TGCACTGGATGGTTACACTATGG + Intergenic
1029098775 7:98110142-98110164 TTAACTGCATGCTTTCTCTAAGG - Intronic
1029803897 7:102976663-102976685 GGAACTGGGTGGGCTCTTTAAGG - Intronic
1031391153 7:121216626-121216648 TGAACTGGGTGGTCTCCTTTGGG - Intronic
1031964353 7:128017003-128017025 TGAATCTGATGGTTACTTTAAGG - Intronic
1033958048 7:146876398-146876420 TGAACAATATGCTTTCTTTACGG - Intronic
1035392203 7:158511915-158511937 TGAAATAGATGATTTTTTTAGGG + Intronic
1037438775 8:18892855-18892877 TGAAGTGGATGGATTATTTGAGG - Intronic
1039773098 8:40708507-40708529 AGAACAGAATGGTTTGTTTACGG - Intronic
1042158148 8:65866278-65866300 GGAACTGGGTGGGCTCTTTAAGG - Intergenic
1042417952 8:68547399-68547421 TGAACTGGAAGTCTTCTTTTTGG - Intronic
1043050864 8:75383924-75383946 TAAACAGGATGGATTTTTTAGGG - Intergenic
1044255885 8:90060652-90060674 TGAACTGGATGCTTTACTGAAGG - Exonic
1044513291 8:93109151-93109173 TTAATTGCATGGTTTCTTGAGGG + Intergenic
1046304680 8:112349734-112349756 TAAATTGGATGATTTTTTTAAGG - Intronic
1050563403 9:6857535-6857557 TATCCTGGATGGTTCCTTTAGGG - Intronic
1050708240 9:8428629-8428651 TGCACTGGATTTTTTCTTGAAGG - Intronic
1052186395 9:25601428-25601450 TTGTATGGATGGTTTCTTTAAGG + Intergenic
1058082940 9:100718518-100718540 AGAGCTGCATGGTTCCTTTAAGG - Intergenic
1059889179 9:118782257-118782279 TGGACTGGATGATTTCCCTAAGG + Intergenic
1061279737 9:129590672-129590694 GGGGCTGGATGGTTTCTTTGAGG + Intergenic
1203365404 Un_KI270442v1:250989-251011 TGGATTGGTTGGTTTCTTTGGGG + Intergenic
1203376422 Un_KI270442v1:381368-381390 TGAATTGGTTGGTTGCTTTGTGG - Intergenic
1188621014 X:32223946-32223968 TGACCTGGATGGCATTTTTAAGG - Intronic
1190125068 X:47697662-47697684 AGAACTGGATGTGCTCTTTATGG + Intergenic
1190390354 X:49925121-49925143 TGAAGTGTATAGTTTCTTTTAGG + Intronic
1192282461 X:69700665-69700687 GGAACTGGGTGGGCTCTTTAAGG + Intronic
1193834247 X:86322632-86322654 TGAACTGCATGGCTCCTTGATGG + Intronic
1195995858 X:110731002-110731024 TGCACTTGATGGTCTCTTTGTGG + Intronic
1196429223 X:115604885-115604907 GGTACTTGATGGTGTCTTTAAGG - Intronic
1196611483 X:117719644-117719666 TTAACTGGATGGTGTGTGTATGG - Intergenic
1197308673 X:124877016-124877038 TGAACTGGAATGATTTTTTAAGG - Intronic
1199757512 X:150879140-150879162 TCTACTGGAAGGTTTCTCTACGG - Intronic