ID: 1179571204

View in Genome Browser
Species Human (GRCh38)
Location 21:42279861-42279883
Sequence ACACGGGACCCGAAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179571199_1179571204 -7 Left 1179571199 21:42279845-42279867 CCTCCCAGGAGTAGCTACACGGG 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1179571204 21:42279861-42279883 ACACGGGACCCGAAGGCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 134
1179571201_1179571204 -10 Left 1179571201 21:42279848-42279870 CCCAGGAGTAGCTACACGGGACC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1179571204 21:42279861-42279883 ACACGGGACCCGAAGGCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 134
1179571193_1179571204 30 Left 1179571193 21:42279808-42279830 CCAGAACAAGCTGGCATCTTGGT 0: 1
1: 0
2: 2
3: 13
4: 175
Right 1179571204 21:42279861-42279883 ACACGGGACCCGAAGGCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179571204 Original CRISPR ACACGGGACCCGAAGGCAGA TGG Intronic
901605667 1:10457247-10457269 ACTCGGGAGGCTAAGGCAGAAGG - Exonic
901616447 1:10543713-10543735 ACTCGGGAGGCTAAGGCAGAAGG - Intronic
904068388 1:27773229-27773251 AGCCGGGACCCGCAGGCTGACGG - Exonic
904475548 1:30762414-30762436 AGATGGGACCAGCAGGCAGAAGG + Intergenic
908271121 1:62423725-62423747 ACACGGGAGGCTGAGGCAGAAGG + Intergenic
910208626 1:84772559-84772581 AGGCGGGACCTGAACGCAGAAGG - Intergenic
911075778 1:93873491-93873513 ACTCAGGACGCTAAGGCAGAAGG + Intronic
911102364 1:94104737-94104759 ACACAGGGCCCGAAGGGAGGAGG + Intronic
912976165 1:114332172-114332194 ACATGGGACCCAAAAGCAGAGGG + Intergenic
913318722 1:117574254-117574276 ACAGGGGCCCCGAAGGCTGATGG - Intergenic
916007596 1:160676266-160676288 ACACGGGGCCCCAGGTCAGAAGG + Intergenic
920042601 1:203112259-203112281 ACTCGGGAGCCTGAGGCAGAAGG - Intronic
921195241 1:212750231-212750253 ACAAGGGAACCGAAGGGAGAGGG + Intronic
922173826 1:223179303-223179325 ACAGAGGGGCCGAAGGCAGAAGG - Intergenic
922966069 1:229691992-229692014 ACTCAGGACACTAAGGCAGAAGG - Intergenic
923776555 1:236983777-236983799 ACTCGGGAGGCTAAGGCAGAAGG + Intergenic
1066635909 10:37500068-37500090 ACACGGGAGGCTAAGGCAGGAGG - Intergenic
1067143180 10:43673257-43673279 ATACAGGGCCAGAAGGCAGAGGG - Intergenic
1069475647 10:68729841-68729863 ACACAGGAGCCTAAGGCAGGAGG - Intronic
1074248117 10:111714472-111714494 ACAGTGGCCCCGAGGGCAGAGGG + Intergenic
1076990474 11:270960-270982 ACAGGGGATCGGGAGGCAGAGGG + Intergenic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1078338892 11:10485115-10485137 ACAGGGGACCCCAGGGCAGAGGG - Intronic
1080072820 11:28110221-28110243 ACAGCGGAACCAAAGGCAGACGG + Exonic
1085497200 11:76980565-76980587 ACACAGGAGGCTAAGGCAGAAGG + Intronic
1086355882 11:85998667-85998689 ACTCGGGAAGCTAAGGCAGAGGG + Intronic
1089167684 11:116489634-116489656 ACACTGGACCGGGAGGCAGATGG + Intergenic
1091874040 12:3918955-3918977 AGACTTGACCCGAAGGCACAGGG - Intergenic
1092393517 12:8103626-8103648 ACTGGGGACGCCAAGGCAGAGGG - Intergenic
1093173003 12:15880102-15880124 ACACGGGACACTGAGGCAGGAGG - Intronic
1094235922 12:28166081-28166103 ACTCGGGAGGCCAAGGCAGAAGG + Intronic
1095429636 12:42119295-42119317 ACACGGGAAGCTAAGGCAGGAGG + Intronic
1095791818 12:46175981-46176003 ACACGGGAGGCCAAGGCAGGAGG - Intergenic
1096462267 12:51828628-51828650 CCACAGGACCCGAGGGCAGCAGG - Intergenic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1096816093 12:54202791-54202813 ACATGGGAGGCCAAGGCAGAAGG + Intergenic
1100221491 12:92508760-92508782 ACTCGGGAGGCTAAGGCAGAAGG + Intergenic
1100806763 12:98293393-98293415 ACTTGGGAGCCGAAGGCAGGAGG - Intergenic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1103571167 12:121846140-121846162 ACACGGGAGGCCAAAGCAGAAGG - Intronic
1105284407 13:18992904-18992926 AGACGAGAACAGAAGGCAGAAGG + Intergenic
1107999735 13:45895075-45895097 ACACCCTACCCGAAAGCAGACGG - Intergenic
1110108194 13:71707420-71707442 ACACGGTGCCCAAATGCAGATGG + Intronic
1111062938 13:83046765-83046787 ACCCTGAACCAGAAGGCAGAGGG + Intergenic
1117131772 14:52694811-52694833 ACACAGGACCAGAAACCAGAGGG + Intronic
1117548699 14:56812702-56812724 ACACTGGACCCTACGGCAGATGG - Intergenic
1119431818 14:74573395-74573417 GAACTGGACCAGAAGGCAGAGGG - Intronic
1121242526 14:92440734-92440756 ACAGGGGAGCCAAAGGGAGAGGG + Intronic
1121464369 14:94105020-94105042 ACACCGGACCCGAAGGTAAGTGG + Intronic
1136470049 16:30473891-30473913 CCAAGGGGCCCCAAGGCAGAGGG - Intronic
1138257357 16:55577900-55577922 TCAGGGGACCGGAAGCCAGATGG - Intronic
1138587929 16:57984010-57984032 ACTCGGGAGGCTAAGGCAGAAGG - Intronic
1141614014 16:85200049-85200071 ACAGAGGAGACGAAGGCAGAAGG - Intergenic
1145872833 17:28289713-28289735 ACTCAGGAGCCTAAGGCAGAAGG + Intergenic
1146621960 17:34405642-34405664 ACTCGGGAGGCTAAGGCAGAAGG + Intergenic
1146854730 17:36253070-36253092 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146865890 17:36335306-36335328 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1146870630 17:36376962-36376984 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146877988 17:36428043-36428065 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147068760 17:37935918-37935940 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147073513 17:37977586-37977608 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1147080283 17:38015455-38015477 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1147085035 17:38057124-38057146 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147096231 17:38139415-38139437 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147100981 17:38181090-38181112 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1149887711 17:60357342-60357364 ACACGGGAAGCCAAGGCAGGAGG + Intronic
1150006040 17:61469606-61469628 ACACTGGACCTGGAAGCAGAAGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1152659021 17:81533952-81533974 ACACGGTACCCGGGGGCAGCAGG - Intronic
1155292947 18:24359329-24359351 ACACAGGAGGCGAAGGCAGGAGG - Intronic
1159855835 18:73586524-73586546 ACACTGGAAAAGAAGGCAGAAGG + Intergenic
1160149836 18:76390650-76390672 ACCCGGGTCCCGCAGGCAGGAGG + Intronic
1161155384 19:2729986-2730008 CAGCGGGACCCTAAGGCAGAAGG - Intronic
1161232781 19:3183271-3183293 ACTCGGAAACCCAAGGCAGAAGG - Intergenic
1161884788 19:6986054-6986076 GCAAGGGACCCACAGGCAGAAGG + Intergenic
1163627824 19:18400777-18400799 ACTCGGGAACCTAAGGCAGGAGG + Intergenic
1165461487 19:35946520-35946542 AAACAGGACCAGCAGGCAGAGGG + Intergenic
1165774067 19:38394831-38394853 ACTCGGGGCCCGAAGGGAGCGGG + Intronic
1167112979 19:47472703-47472725 ACTCGGGAGGCCAAGGCAGAAGG - Intergenic
1167269863 19:48500660-48500682 TGACGGGACCTGGAGGCAGAGGG + Intronic
1167336016 19:48886403-48886425 ACTCTGGACCCATAGGCAGAAGG - Intronic
924991396 2:315809-315831 ACAGGGGACCAGAAGACAGGAGG - Intergenic
926668824 2:15555140-15555162 ACACGGGAGGCTAAGGCAGGAGG + Intronic
931277427 2:60756169-60756191 TCCCGGGACCTAAAGGCAGAGGG + Intergenic
935122948 2:100198223-100198245 ACACAGGAGCCAAAGGCAGGTGG - Intergenic
936096187 2:109532031-109532053 ACACGGGACCCCACGGCACCAGG + Intergenic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
940358998 2:152777132-152777154 ACACGGGAGGCTGAGGCAGAAGG - Intergenic
940943329 2:159588083-159588105 ACTCGGGAGGCTAAGGCAGAAGG + Intronic
944062892 2:195588125-195588147 ACTCGGGAACCTGAGGCAGAAGG + Intronic
944067541 2:195634937-195634959 ACTCGGGAGGCTAAGGCAGAAGG + Intronic
944122959 2:196260978-196261000 ACATGGGACCCGAAGTCATATGG - Intronic
1169311006 20:4539963-4539985 AAATGGGACTTGAAGGCAGATGG - Intergenic
1170217617 20:13908224-13908246 ACTCGGGAGGCTAAGGCAGAAGG - Intronic
1171463898 20:25314568-25314590 ACTCGAGAGCCTAAGGCAGAAGG + Intronic
1172403725 20:34672045-34672067 ACTCGGGACGCTAAGGCAGGAGG - Intronic
1174870559 20:54177269-54177291 ACACGGGAGGCTAAGGCAGGAGG + Intergenic
1175621920 20:60454660-60454682 ACAGGGGACTCGAAGTCAGATGG - Intergenic
1176871067 21:14083769-14083791 ACAAGGGAACCCAAGGTAGAGGG + Intergenic
1179571204 21:42279861-42279883 ACACGGGACCCGAAGGCAGATGG + Intronic
1179942382 21:44648603-44648625 ACAGGGGAGCCTAAGGCACAGGG + Intronic
1182635623 22:31724507-31724529 ACTCGGGAGGCTAAGGCAGAAGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1185211205 22:49571546-49571568 ACTGGGGACCCCAAGGCAGGTGG + Intronic
960583859 3:119303032-119303054 ACACCTGACCCTAAGGCAGTGGG - Intronic
966452406 3:180077217-180077239 ACTCAGGACCCAAAGGCAGGAGG - Intergenic
968791135 4:2663190-2663212 CCAGGGGCCCCGAAGGAAGATGG + Exonic
968898831 4:3421132-3421154 ACAGGCGGCCCGCAGGCAGAGGG - Intronic
971094211 4:23380616-23380638 ACTCGGGAGGCTAAGGCAGAAGG - Intergenic
972655620 4:41060824-41060846 GCACGTGACCCAAAGGCACAGGG + Intronic
973273773 4:48287847-48287869 ACAGGGGAAAGGAAGGCAGAAGG - Intergenic
976434954 4:85006542-85006564 ACACGGGAGGCCAAGGCAGGAGG + Intergenic
978866883 4:113523661-113523683 ACAGGGGAGGCTAAGGCAGAAGG + Intronic
984882872 4:184425747-184425769 ATACAGGACCAGAAGGCAAATGG - Intronic
989063046 5:37429077-37429099 ACTCAGGAGCCTAAGGCAGAAGG - Intronic
991214986 5:64150355-64150377 ACACAGGAGCCCACGGCAGAGGG - Intergenic
994276876 5:97849367-97849389 ACAGGAGACCTGAAGGCAGGTGG + Intergenic
994919448 5:106024514-106024536 ACAGGAGAACCGAAGGCAGAAGG + Intergenic
995142542 5:108749303-108749325 TCCCGGGACCCGAAGGCTGAGGG + Intronic
997475219 5:134138750-134138772 ACAAGGGAACCCAGGGCAGAGGG - Intronic
1000312733 5:160061064-160061086 GCACGGGAACCGTAGGCTGACGG + Intronic
1004264403 6:14136443-14136465 ACACGGGAGCCGCTGGCAGAAGG + Exonic
1007446701 6:41912155-41912177 ACATGGGACACTGAGGCAGAAGG - Intronic
1011900147 6:92284250-92284272 CCACGGGCCCCAAAGGCAGCTGG - Intergenic
1012817182 6:104039096-104039118 AAACGGGAGCAGAAGGCAGAAGG + Intergenic
1013348414 6:109284427-109284449 ACATGGGAGCCCAAGGCAGGAGG - Intergenic
1016972308 6:149775597-149775619 ACAAGGGAGGCCAAGGCAGAAGG + Intronic
1017784087 6:157740504-157740526 ACACAGCACCCCAATGCAGAGGG + Intronic
1019367949 7:644835-644857 ACACGGGACCCTTTGGCCGACGG - Intronic
1021577976 7:22122184-22122206 TCTCGGGACAAGAAGGCAGAAGG - Exonic
1023828693 7:44027034-44027056 ACTCGGGAGGCCAAGGCAGAAGG - Intergenic
1023870258 7:44259401-44259423 ACACAGAGCCTGAAGGCAGAAGG - Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037821054 8:22134717-22134739 ACATGGGACCCGGAGGCTCAGGG - Intergenic
1041108696 8:54466395-54466417 GCCCGGGACCCGAGGGCAGGAGG - Intergenic
1041599536 8:59700135-59700157 ACTTGGGAGCCGGAGGCAGAAGG - Intergenic
1048613880 8:136053276-136053298 ACTCGGGAGGCCAAGGCAGAAGG - Intergenic
1049300519 8:141867127-141867149 ACAGGGGACCCGGAGCCACAGGG + Intergenic
1055731845 9:79286685-79286707 ACCTTGGACCAGAAGGCAGAGGG + Intergenic
1059651290 9:116318643-116318665 ACACGGGATCCCCAGCCAGATGG - Intronic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1190278959 X:48917348-48917370 CCATGGGACCCAAAGGGAGAGGG - Intronic
1190456687 X:50634472-50634494 ACAAGGGAGCCAGAGGCAGAGGG + Exonic
1196821376 X:119703797-119703819 ACTTGGGAGCCCAAGGCAGAAGG - Intergenic
1198206653 X:134472077-134472099 ACTCGGGAGGCGGAGGCAGAAGG - Intronic
1199947800 X:152681803-152681825 CCGCTGGACCAGAAGGCAGATGG + Intergenic
1199961879 X:152786651-152786673 CCGCTGGACCAGAAGGCAGATGG - Intergenic
1200205952 X:154316454-154316476 ACTCGGGACTCTAAGGCAGGAGG + Intronic