ID: 1179571731

View in Genome Browser
Species Human (GRCh38)
Location 21:42282547-42282569
Sequence CAGTGGTCCCAGATGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179571731_1179571741 26 Left 1179571731 21:42282547-42282569 CCTCCTTCCATCTGGGACCACTG 0: 1
1: 0
2: 5
3: 23
4: 263
Right 1179571741 21:42282596-42282618 CTCTCACTCACTCTGTGCTCAGG 0: 1
1: 0
2: 4
3: 34
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179571731 Original CRISPR CAGTGGTCCCAGATGGAAGG AGG (reversed) Intronic
900013276 1:133462-133484 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
900043341 1:489449-489471 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
900064778 1:724446-724468 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
901879050 1:12183197-12183219 CTGTGGACCCAGATGGGAGGCGG + Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902161241 1:14532088-14532110 AAGTGGTGCAAGAAGGAAGGTGG + Intergenic
902615563 1:17621736-17621758 CAGTGGTCCCAGGTGGGACCTGG + Intronic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
904532890 1:31180914-31180936 CATAGGTCCAAGATGGAGGGGGG + Exonic
905319450 1:37105569-37105591 GAGTGGGCACAGATGCAAGGAGG + Intergenic
906277375 1:44526596-44526618 TGGTGGTGCCAGATTGAAGGAGG - Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
911032168 1:93500684-93500706 TAGTGGTCCCAGAAGGAAGGGGG + Intronic
911259781 1:95671871-95671893 CAGTGGTCTCAAATGGATGCTGG - Intergenic
914449054 1:147774466-147774488 CCGTGGACCCAGTTGGAATGAGG + Intergenic
915076306 1:153310761-153310783 CAGTGGTGCCACATAGTAGGTGG - Intergenic
915400624 1:155619189-155619211 CAGTGGCCCAAGGTGGATGGAGG - Intergenic
915418149 1:155758195-155758217 CAGTGGCCCAAGGTGGATGGAGG - Intronic
915871533 1:159564875-159564897 CTGTGGTCTCTGAAGGAAGGTGG + Intergenic
915944532 1:160140217-160140239 CTGTGGTTTCAGGTGGAAGGTGG - Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
919890934 1:201973814-201973836 CTGTGGTGCCAGATTGAAGTTGG - Intergenic
921046653 1:211482539-211482561 AAGGGGTCCCAGGTGGAGGGAGG + Intronic
921219533 1:212963326-212963348 CAGTGGCCCCAGTGGGCAGGGGG - Intronic
921349266 1:214218980-214219002 TAGTGGTCAAAGAAGGAAGGAGG - Intergenic
921766999 1:218983704-218983726 GAGGGGTCCCAGATGGAAGGGGG + Intergenic
922099677 1:222470465-222470487 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
922459320 1:225802842-225802864 CAGTGGCCTCAGGTGGAATGGGG + Intergenic
922480618 1:225938093-225938115 CAGTGGCCTCAGGTGGAATGGGG - Intronic
923175803 1:231463742-231463764 GTGAGGTCCCAGCTGGAAGGCGG + Intergenic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
924252445 1:242146046-242146068 CAGGGGTCAGAGATGGAAAGTGG + Intronic
924342879 1:243052134-243052156 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
1065104276 10:22365542-22365564 AAGTGGTACCAGATAGGAGGGGG - Intronic
1066733604 10:38453420-38453442 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
1067515584 10:46938783-46938805 CTGTGATCCCAGAGAGAAGGGGG - Intronic
1067646667 10:48113032-48113054 CTGTGATCCCAGAGAGAAGGGGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069614639 10:69799271-69799293 CAGGGCTCCCAGAAGAAAGGGGG - Intergenic
1070525173 10:77290020-77290042 CAGGGGTTAGAGATGGAAGGAGG + Intronic
1070798344 10:79230244-79230266 CAGTGGTCCCAAGGGGAAAGGGG - Intronic
1072893554 10:99346267-99346289 CAGTTGTCCAAGATGGGATGAGG + Intronic
1073116563 10:101094808-101094830 AAGTGGGCACAGGTGGAAGGAGG - Intronic
1073281715 10:102359417-102359439 CAGTCCTCCCAGAAAGAAGGTGG + Exonic
1073812320 10:107164551-107164573 GAGGGGTCCCAGAACGAAGGTGG + Intergenic
1073921638 10:108466281-108466303 GAGGGGTCCCAGACCGAAGGTGG + Intergenic
1074132170 10:110589515-110589537 CAGTGGTTGCAGATGGATGGGGG - Intronic
1074761465 10:116670069-116670091 CCGCGGTCCCACCTGGAAGGTGG + Intronic
1074769673 10:116725127-116725149 CAGGGATCCCACCTGGAAGGGGG + Intronic
1074850165 10:117433035-117433057 CTGTGGTCTCAGATGGCAGATGG + Intergenic
1076387424 10:130067310-130067332 TAATGGTCCCAGATGGAGTGAGG - Intergenic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076969612 11:125666-125688 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
1078028432 11:7722456-7722478 CAGTGGTTCAAGATGGGAGAGGG + Intergenic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081220565 11:40455276-40455298 CACTAGTTCCAGATGGAAGCAGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1092923558 12:13253856-13253878 CAGTGGTCCCACACGAAAGAAGG + Intergenic
1094070750 12:26410490-26410512 GTGTGGTCCCAGATGGAAACTGG + Intronic
1095132189 12:38556559-38556581 CAGTGATCCCTGATTGATGGAGG - Intergenic
1096918297 12:55057216-55057238 CAGTAGTCCCAGAGTAAAGGTGG - Intergenic
1097287922 12:57891957-57891979 CAGGGGTACCAGATGTAAGGGGG + Intergenic
1101338261 12:103816508-103816530 CAGTGGACCCTGATGGTAGAAGG - Intronic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1103890138 12:124232354-124232376 CAGGGGCCCCAGGTGGGAGGTGG - Intronic
1103996809 12:124835378-124835400 CTGTGGTCCCAGCTACAAGGAGG - Intronic
1104781822 12:131426498-131426520 CAGTAGTTCCAGAAGGGAGGAGG - Intergenic
1105476701 13:20734265-20734287 CAGTGGTCCAGGATGCAAGAAGG + Intronic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1105777350 13:23676214-23676236 CTGTGGTCCCAGATACTAGGAGG + Intergenic
1105847855 13:24308502-24308524 CCGTGGTCCCAGGTGGGCGGCGG - Intronic
1107333019 13:39321816-39321838 GAGTGGGCCCAGAGGGAATGAGG - Intergenic
1107351547 13:39520062-39520084 CTGGGCTCCCAGATGGAGGGTGG - Intronic
1109184293 13:59250661-59250683 CAGTGGTCCGAGATGGATTTAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112567908 13:100566916-100566938 GAATTGTTCCAGATGGAAGGAGG - Intronic
1114549244 14:23523750-23523772 CTGGGGTTCCAGATGGAATGGGG - Exonic
1116856719 14:49959140-49959162 CAGTGAGCCGAGATGGGAGGCGG - Intergenic
1121089339 14:91170385-91170407 CAGTGGTCCCAGAGGTGAGTGGG - Intronic
1121735818 14:96217519-96217541 CAGCTGTCCCAGATGGACGCTGG + Intronic
1125909189 15:43421032-43421054 CAGTGGTCCGAGAAGGTGGGCGG + Exonic
1126271811 15:46828102-46828124 TAGTGGTCCCAGATCTGAGGTGG - Intergenic
1127054104 15:55114060-55114082 CCATGGGCCCAGAAGGAAGGGGG + Intergenic
1127295323 15:57604156-57604178 CAGTGTTCCCCAATGGAAGTAGG + Intronic
1127601330 15:60540245-60540267 CAGTGCTCTCAGCTGTAAGGAGG - Intronic
1128292863 15:66491768-66491790 CACAGGTCCCACAAGGAAGGTGG - Exonic
1129661748 15:77556609-77556631 AACTGGGCCCAGGTGGAAGGTGG - Intergenic
1129734181 15:77950735-77950757 CAGTGGTCCCTTTGGGAAGGTGG - Intergenic
1129763550 15:78146698-78146720 CAGAAGTCTCAGATGGAAGTTGG - Intronic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1129841402 15:78745256-78745278 CAGTGGTCCCTTTGGGAAGGTGG + Intergenic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1130144353 15:81261955-81261977 CTGAGGTCCCAGCTGGTAGGAGG + Intronic
1131435321 15:92417236-92417258 CCTTGGTGTCAGATGGAAGGAGG - Intronic
1132546398 16:535288-535310 CAGTGGCCGCAGATGGAGCGGGG + Intronic
1132548704 16:545360-545382 CGGTGGGCCGAGGTGGAAGGGGG - Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132568075 16:632206-632228 CACTGGTCCCGGATGGAAGGAGG - Intronic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1135749004 16:25041489-25041511 CTGTGGTCCCAGCTGCATGGGGG + Intergenic
1138533637 16:57648289-57648311 CAGTGGTCAGAGGTGGCAGGAGG + Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139196435 16:64924150-64924172 AAGTGGTCCCAGATGGCTAGGGG - Intergenic
1140504082 16:75459441-75459463 GAGTGGGGCCAGCTGGAAGGAGG - Intronic
1140511517 16:75512243-75512265 AAGTGGGGCCAGCTGGAAGGAGG - Intergenic
1142451067 16:90173456-90173478 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
1142456496 17:60239-60261 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
1143004404 17:3819118-3819140 TAGTGTTCCTAGATGCAAGGGGG + Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144328960 17:14207199-14207221 CAGTGCTCTCAGCTGGGAGGGGG - Exonic
1145273707 17:21417945-21417967 CAGTCATCCCAGTTGGCAGGAGG - Exonic
1146313570 17:31789798-31789820 CAGTTCTCACACATGGAAGGTGG + Intergenic
1147127107 17:38378670-38378692 CAGTGCTCCCAAATGGAGAGAGG - Intronic
1147178908 17:38673084-38673106 CAACGGTCCGAGATGGAAGGAGG + Exonic
1148954903 17:51345580-51345602 CAGTGGTCCCATCTGTAAAGTGG - Intergenic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152829368 17:82487699-82487721 CAGTGGTCCCAGCTCGAAGTAGG + Intronic
1152844410 17:82591055-82591077 CAGTGCTGACAGATGGGAGGTGG + Intronic
1155025299 18:21935340-21935362 CTGCAGTCCCACATGGAAGGGGG - Intergenic
1155630380 18:27886310-27886332 CAGTGGTCCCCAAGGGAATGAGG - Intergenic
1157491106 18:48124498-48124520 CAGAGGAGCCAGCTGGAAGGGGG + Intronic
1160438332 18:78868211-78868233 CAGTGGACCTAGTTGGAAGTGGG - Intergenic
1160646417 19:195592-195614 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
1160818386 19:1046726-1046748 CAGTCGTGCCAGATGGTGGGCGG + Intronic
1160944097 19:1633192-1633214 CTGTGGCCCCCGATGGAAGGGGG - Intronic
1161310260 19:3589970-3589992 CAGGGGTCCCAGCGGGAAGTTGG + Intronic
1163328452 19:16620315-16620337 CAGCGGACACAGCTGGAAGGAGG - Intronic
1163381864 19:16974389-16974411 CTGTGATCCCAGGTGGCAGGGGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165963061 19:39551536-39551558 CAGTGTTCCCAGCTGGAGTGTGG - Intergenic
1166159052 19:40938076-40938098 CACTGGCCCCAGCTGGAGGGAGG - Intergenic
1166343301 19:42151133-42151155 CTGGGGACCCAGATGGGAGGAGG + Intronic
1167148976 19:47698284-47698306 CACTGGCCCCAGGTGGCAGGAGG + Intronic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925323288 2:2993753-2993775 CAGAGGTCCCAGTAGGTAGGTGG + Intergenic
925933607 2:8731837-8731859 CAGATGTCCCAGTTAGAAGGGGG - Exonic
927654335 2:24932782-24932804 CAGAGGTGGCAGATGGAAGGAGG + Intergenic
928658548 2:33478006-33478028 CAGTGTTCCCTCATGGCAGGGGG - Intronic
929810973 2:45188989-45189011 GAGTGGTCCCAAATGAATGGAGG - Intergenic
931253630 2:60553030-60553052 CAATGGTTCCAGATGGGATGAGG + Intronic
932103617 2:68923544-68923566 GAGTGGGGCCAGATGGAAGACGG - Intergenic
932141091 2:69278839-69278861 CAGTGGTGGCAGTTGGAAGGGGG + Intergenic
932174351 2:69585969-69585991 GGGTGGTGCCAGAGGGAAGGTGG - Intronic
933178577 2:79204170-79204192 CAGAGGTCCCAGAGGGGAAGTGG + Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
936039704 2:109140946-109140968 CAGCAGCCCCGGATGGAAGGTGG - Intronic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
937225982 2:120368995-120369017 GAGAGGTCCTGGATGGAAGGAGG + Intergenic
938560529 2:132468713-132468735 AGGTGGTTACAGATGGAAGGTGG + Intronic
940005901 2:149009435-149009457 TAGGGGACCCAGATGGATGGAGG - Intronic
940372414 2:152918069-152918091 CAGTGGGCCCAGATGCAATGCGG + Intergenic
946227709 2:218273032-218273054 CAGTGTTCCCAGCTGGATGGTGG + Intronic
947111247 2:226721627-226721649 GGGTGGTCCCAGATGGCAGTGGG + Intergenic
948150235 2:235739135-235739157 CAGTGTCCCCAGATGCAAAGGGG - Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
1170747711 20:19115512-19115534 CAGAGGTCCCAGAAGGGGGGAGG + Intergenic
1173228644 20:41177116-41177138 CAGTGGTACCAGAAGGTAGATGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173920437 20:46740702-46740724 CGGTGGAACAAGATGGAAGGTGG + Intergenic
1175201029 20:57277773-57277795 CAGGGGCCCCAGCTGGAAGTTGG - Intergenic
1176279094 20:64290624-64290646 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1181639837 22:24190648-24190670 CAGGGGTTCCAGATGGACAGGGG + Intergenic
1181944351 22:26504380-26504402 CAGTGGAACTAAATGGAAGGGGG - Intronic
1182016664 22:27046084-27046106 GAGTGGCCTCAGAAGGAAGGAGG - Intergenic
1182270031 22:29147639-29147661 CTGTTTTCCCAGATGCAAGGAGG - Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1184001805 22:41680180-41680202 CAGAGGCCCCAGATGGAAACAGG + Intronic
1184022836 22:41832753-41832775 CAGCGGTCGCAGGTGGAGGGTGG + Intergenic
1184461243 22:44639451-44639473 CAGAGATGCCACATGGAAGGAGG + Intergenic
1185180303 22:49356279-49356301 CTGAGGTCTCAGATGGAAAGGGG - Intergenic
1185270909 22:49929040-49929062 CAGAGGTCCCGGCTGGAAGATGG - Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
952932850 3:38373551-38373573 CACTGGTCCCTGATGGATGGAGG + Intronic
954360872 3:50122215-50122237 CAGGGCTCCCAGATGGAAGCAGG + Intergenic
955116601 3:56011382-56011404 CAGAGCTCCGAGATGCAAGGTGG + Intronic
956048760 3:65224729-65224751 CAGGGGTTTCATATGGAAGGTGG + Intergenic
959785756 3:110295448-110295470 AGGTGGTCTCAGATGGAATGAGG - Intergenic
959926025 3:111922876-111922898 GAGTGGTCTTTGATGGAAGGAGG - Intronic
961524879 3:127490456-127490478 CAGTGGTCCCAGTTGTGAGCAGG - Intergenic
962039830 3:131695108-131695130 AAATGGTCTCAGATGGAAAGAGG - Intronic
963271166 3:143287080-143287102 AAGTGGGACCAGAAGGAAGGAGG - Intronic
963641059 3:147862318-147862340 AAGGGGTCCCAGATGGAGGAGGG + Intergenic
968371264 3:198223934-198223956 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
969394327 4:6910437-6910459 CAGGGCTCCGAGATGAAAGGGGG - Intronic
969477576 4:7430175-7430197 CACTGTTCCCACATTGAAGGTGG + Intronic
970318142 4:14848986-14849008 CAAAGGTCACAGATAGAAGGAGG - Intergenic
971810268 4:31416332-31416354 CAGTGGGCTGAGATGGAGGGTGG + Intergenic
973897680 4:55431592-55431614 CAGGAGTCCCTGTTGGAAGGGGG - Exonic
975491181 4:74990382-74990404 CAATGTTTCCAGCTGGAAGGAGG + Intronic
976000867 4:80371734-80371756 AAGTGGTCTCAGATTGAAAGAGG - Intronic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
978896519 4:113895103-113895125 CAGTGGTTGCAGATGGAAGTTGG - Intergenic
979328430 4:119404219-119404241 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
981121521 4:141056745-141056767 CAGGGCTCCCAGATGGGAAGGGG - Intronic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
982922261 4:161290580-161290602 CTGTGGTCCCAGGTTGAAGGAGG + Intergenic
983795866 4:171861989-171862011 CAATGGTCTTATATGGAAGGTGG + Intronic
983998429 4:174213511-174213533 CAGGGGGCTCAGTTGGAAGGTGG + Intergenic
984124877 4:175795627-175795649 CTGTGGTCCCAGCTGGGAGGAGG + Intronic
986971563 5:13343200-13343222 CAGTGGTCCTTAATGGATGGAGG - Intergenic
987121586 5:14772959-14772981 CAGTGGTCCCACTTGGAGGCAGG - Intronic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
995829147 5:116334455-116334477 CAGTGGGCCCACAGGGATGGGGG - Intronic
998432652 5:142079730-142079752 CAGTAGCCACAGATGGCAGGTGG - Intergenic
999283866 5:150382513-150382535 CAGTGGTCCCTATTGGAATGGGG - Intronic
1000182282 5:158822959-158822981 GAGTGGTCCCACAAGAAAGGTGG + Intronic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000805487 5:165785504-165785526 CAGTGCTCCCAGATGAACTGGGG - Intergenic
1002087996 5:176787746-176787768 GAATGGTCCCAGAAGGAAGAGGG - Intergenic
1002099099 5:176848599-176848621 CCCTATTCCCAGATGGAAGGTGG + Intronic
1002529102 5:179833260-179833282 CCGTGGTCCCAGGTGGCGGGAGG - Intronic
1002730502 5:181329480-181329502 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
1002754027 6:144624-144646 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1006417834 6:33915361-33915383 CAGCTGTCCCAGTTGGAAGCTGG + Intergenic
1006803919 6:36776566-36776588 GGGTGGTCCCAGAGGGATGGGGG + Intronic
1007198266 6:40082438-40082460 GAGTGGTCCCAGGTGGAGGAGGG - Intergenic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1008693838 6:54010856-54010878 AAGTGGTCCCAGTGGGAATGAGG + Intronic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1011249150 6:85352678-85352700 CAGTGGGACAAGATGGGAGGTGG - Intergenic
1013928591 6:115502717-115502739 CAGTGGTCCCAGCTGTACGTTGG - Intergenic
1016548744 6:145253694-145253716 CAGTGGTTGCAGTTGGATGGTGG - Intergenic
1020561067 7:9728960-9728982 CTGTGTTCCCAGGTGGCAGGGGG + Intergenic
1020967239 7:14886712-14886734 CAGGTGGGCCAGATGGAAGGTGG - Intronic
1022474098 7:30699255-30699277 CAGGGGCCACCGATGGAAGGTGG - Intronic
1023817348 7:43961338-43961360 CAGAGGTCCCAGTGGGTAGGGGG + Intergenic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1024075648 7:45816653-45816675 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1024268677 7:47625935-47625957 CAGTGAACCGAGATGGGAGGGGG - Intergenic
1025051801 7:55739143-55739165 CAGTGGTGCCAGTTGGGGGGCGG + Intergenic
1026534416 7:71228293-71228315 CACAGGTCCCAGATGGAACCAGG - Intronic
1027225552 7:76241401-76241423 CAGGGGTCTCAGATGGAAAAGGG + Intronic
1027960446 7:84939712-84939734 CAGTGGTCCCAGAGGGGGTGAGG + Intergenic
1029261078 7:99303271-99303293 CAGTGGCCCACGATGGGAGGAGG - Intergenic
1029741974 7:102496212-102496234 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1029759963 7:102595377-102595399 CAGAGGTCCCAGTGGGTAGGGGG + Intronic
1030673022 7:112357597-112357619 CAGTGCTCCCAAATGTAGGGTGG + Intergenic
1031047111 7:116903723-116903745 CTGTGGGCCCAGAGGCAAGGTGG + Intronic
1032052177 7:128656400-128656422 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
1032077357 7:128842408-128842430 CAGGGGTCCCTGAGGGAGGGCGG + Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1034490100 7:151388585-151388607 CAGGGGTCCCAGAAGCCAGGTGG - Intronic
1035053307 7:156017027-156017049 CAGTGGTCTCATCTGGAAAGTGG + Intergenic
1035064944 7:156097440-156097462 GAGGGGTCCCAGATGAAAAGTGG + Intergenic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1036010120 8:4712758-4712780 CAGTGGTCCCAAAAGAAAGAAGG - Intronic
1038103905 8:24412132-24412154 CAGTGGGGCCAGTTGGAGGGTGG + Intergenic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038466790 8:27772151-27772173 CAAAGGCCGCAGATGGAAGGTGG + Intronic
1041460977 8:58111490-58111512 CAGTGTTCCCACATGGAACCAGG - Intronic
1042599126 8:70480588-70480610 AAGTGGTCCAAAATGGGAGGTGG - Intergenic
1043425627 8:80145768-80145790 CACTTGTCCGAGATGAAAGGAGG + Intronic
1043994769 8:86799462-86799484 CAGTGGTCTCCCATGGCAGGAGG + Intergenic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1046086703 8:109445515-109445537 CAGTGGTCCCAGCGGGAGTGCGG - Exonic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049685664 8:143938320-143938342 TGCTGGTCCCAGAGGGAAGGAGG + Intronic
1051480953 9:17560050-17560072 AAATGTTCACAGATGGAAGGTGG + Intergenic
1052419424 9:28223332-28223354 CTGTGGTCTCACATGGAAGAAGG + Intronic
1056297329 9:85206003-85206025 CACTGGTCCCAGGAGGAAGATGG + Intergenic
1056885960 9:90444097-90444119 CTGTGGTCACACATGGAAGCTGG - Intergenic
1057228743 9:93306083-93306105 TGGTGGTCCCAGTTAGAAGGAGG + Intronic
1058351877 9:104034795-104034817 CATTGCTCCCAGATGGACTGTGG - Intergenic
1062475542 9:136725019-136725041 CAGTGGTCCCAGAGGGGGTGAGG + Intergenic
1062754913 9:138281990-138282012 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
1203578822 Un_KI270745v1:26159-26181 CAGTGGTGCCAGTTGGGGGGCGG - Intergenic
1185916704 X:4043660-4043682 CTGTGGTCCCAGCTGCATGGGGG - Intergenic
1187486683 X:19710891-19710913 AAATGGTCACAAATGGAAGGGGG - Intronic
1188635311 X:32422703-32422725 CAGTGTCCCTAGATGGAATGAGG - Intronic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1202381445 Y:24278777-24278799 CAGTGGTGCCAGTTGGGGGGTGG - Intergenic
1202489340 Y:25391349-25391371 CAGTGGTGCCAGTTGGGGGGTGG + Intergenic