ID: 1179571858

View in Genome Browser
Species Human (GRCh38)
Location 21:42283205-42283227
Sequence CCTTCTGAGGGGGGGATGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179571848_1179571858 8 Left 1179571848 21:42283174-42283196 CCAGCGAGATTTGACAGTAGTGT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG 0: 1
1: 1
2: 1
3: 11
4: 259
1179571847_1179571858 15 Left 1179571847 21:42283167-42283189 CCAAAGTCCAGCGAGATTTGACA 0: 1
1: 0
2: 1
3: 7
4: 71
Right 1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG 0: 1
1: 1
2: 1
3: 11
4: 259
1179571846_1179571858 20 Left 1179571846 21:42283162-42283184 CCTCTCCAAAGTCCAGCGAGATT 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG 0: 1
1: 1
2: 1
3: 11
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179571858 Original CRISPR CCTTCTGAGGGGGGGATGGC GGG Intronic
903389776 1:22955459-22955481 CCGGCTGAGGGTGGGATGGTGGG + Intronic
903427695 1:23266623-23266645 CCTTCTGATGGGGGAATGAATGG + Intergenic
903459076 1:23508391-23508413 CTCCCTGAGGGGTGGATGGCAGG + Exonic
903703444 1:25267679-25267701 CCCTCTCAGGGGTGGGTGGCAGG - Intronic
903712711 1:25338008-25338030 CCCTCTCAGGGGTGGGTGGCAGG - Exonic
904308407 1:29606706-29606728 CCTTCTGAGAGGGAGATGATTGG + Intergenic
904315287 1:29656168-29656190 CCTCCTGAGGTGGGGGAGGCAGG - Intergenic
905328899 1:37178244-37178266 CCTACTGAAGGGGGGCAGGCAGG - Intergenic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906079116 1:43071924-43071946 CCTTCTGGGGATGGGATGACAGG + Intergenic
907320089 1:53596556-53596578 CCCTCTGCGAAGGGGATGGCAGG + Intronic
907556436 1:55348531-55348553 CATCCTGAGGGAGGCATGGCTGG + Intergenic
914802910 1:150973981-150974003 CGTTATGAGGTGTGGATGGCTGG - Intronic
915013899 1:152715137-152715159 CCTTCAGAGGCAGGAATGGCAGG + Intergenic
915249853 1:154580171-154580193 TCTCCTGAGGCGGGGATGGCGGG + Intergenic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
919799824 1:201346947-201346969 CTTTCTGGGGGGGGCAGGGCTGG - Intergenic
920206095 1:204293035-204293057 TGTTCTGAGGGTGGGATGACTGG + Intronic
920211518 1:204332064-204332086 CCTCCTGAGGGGCGGAGTGCTGG + Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920331378 1:205211071-205211093 CCTTCTGAGGAGGGGAGGAAGGG - Intronic
920824898 1:209416067-209416089 ACTTGTCAGGTGGGGATGGCAGG - Intergenic
922088539 1:222373703-222373725 CCCTCTGAGGGGGGCAGGCCAGG + Intergenic
924244747 1:242073258-242073280 CCTCCTGAGGGGAGGAGGACAGG + Intergenic
924796843 1:247298903-247298925 CCTTCTGATGGGGGCTGGGCAGG - Exonic
1064622678 10:17230402-17230424 CCCTCGGGGGCGGGGATGGCGGG + Intronic
1066287461 10:33982185-33982207 CCTTGTGAGAGGGGGAGTGCAGG + Intergenic
1067065506 10:43101990-43102012 CCTCCTGAGGAGGGTGTGGCAGG + Intronic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1070829902 10:79411836-79411858 CCTTCTCAGAGTGGGATGGCAGG - Intronic
1071790384 10:88947373-88947395 CCTTTTTAGGGGGTGATGGTGGG - Exonic
1072704879 10:97673933-97673955 CCTTCTGATGTGGGGGAGGCTGG + Exonic
1073047629 10:100649969-100649991 CCTACTGAGGGGTGGGGGGCAGG + Intergenic
1076188156 10:128464624-128464646 CCTAATGAGGAGGGGAAGGCAGG - Intergenic
1077095100 11:795825-795847 CCTTGGGGGTGGGGGATGGCTGG + Intronic
1083775777 11:64893780-64893802 CCTTCTGAGTGGGGGAGATCTGG - Intergenic
1084243253 11:67837218-67837240 CCACCTGAGAGGGGGTTGGCAGG + Intergenic
1084650868 11:70488509-70488531 CCTTCAGAGAGATGGATGGCTGG + Intronic
1086642600 11:89178162-89178184 CCTTCACAGGGGTGGATGACCGG + Exonic
1088820660 11:113453924-113453946 CCTTTTGATGGGGGGCTGGGGGG + Intronic
1089195508 11:116692124-116692146 CCTTCAGCTGGGGGGATGGATGG - Intergenic
1089390610 11:118099198-118099220 CTTACTGAGGGGGTGAGGGCAGG - Intronic
1089586586 11:119513367-119513389 CCGACTGAGGGGGAAATGGCTGG + Intergenic
1090424321 11:126596483-126596505 CCTTCTGAAGGGGGGAAGGTAGG + Intronic
1090945623 11:131426979-131427001 CCTTCAGAGGTGGAGAGGGCAGG + Intronic
1092058136 12:5523859-5523881 CCATAAGAGGGAGGGATGGCAGG + Intergenic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1098450727 12:70615655-70615677 CCTTCCAAGGGTGGGGTGGCAGG - Intronic
1101653336 12:106697000-106697022 GCTTCTCAGGGAGGGATGGAGGG + Intronic
1102222750 12:111205412-111205434 CCTTGTGGCGGGGGGATGGAGGG - Intronic
1102494110 12:113307448-113307470 CCCTCTGATGCGGGGATGGTCGG - Intronic
1103339987 12:120216087-120216109 CCTTCTGAGTGGGGGAAGACCGG + Intronic
1104850092 12:131868636-131868658 CCTTCTGAGGTGGGGGCGGGGGG - Intergenic
1104958844 12:132478673-132478695 CCTTCTCGGAGGGGCATGGCAGG - Intergenic
1104977711 12:132559723-132559745 CCTTCTGGGAGCGGGGTGGCAGG + Intronic
1105498601 13:20952232-20952254 ACTTCTGAGGGATGGATGGATGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105894436 13:24706412-24706434 GCTTCTGCTGGGGGGATGTCCGG - Exonic
1106786666 13:33114259-33114281 CCTTCTGAGGGGGTCCTGGCTGG + Intronic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1113895256 13:113760018-113760040 CTTCCTGAGGGGGAGAGGGCTGG + Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1114901196 14:27061170-27061192 CCTGTTGAGGGGTGGAGGGCTGG - Intergenic
1115362968 14:32524328-32524350 AGTTCTGGGGTGGGGATGGCTGG + Intronic
1115591732 14:34872467-34872489 CCTCCTGAGTGTGGGATTGCAGG - Intronic
1116421546 14:44738616-44738638 CCTTGGGAGGGGGCTATGGCAGG - Intergenic
1122780871 14:104142907-104142929 CATTTTGAGGGGCGGATAGCCGG - Intronic
1124069596 15:26378954-26378976 CATACTGAGGGGGCGATGTCCGG - Intergenic
1124237857 15:28005179-28005201 CCTTCTGAGGAGGGGAAGTGGGG - Intronic
1124594416 15:31081300-31081322 CTTTCTCAGGGGGGGAGGGGGGG + Intronic
1126520458 15:49587323-49587345 CCTATTGAAGGGTGGATGGCAGG + Intronic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1128110289 15:65071825-65071847 CCTTCTGCTGGGGGCAGGGCTGG - Intronic
1129261316 15:74369459-74369481 CCTTCTGAGGGAGGAATGTGGGG - Intergenic
1131896150 15:97031990-97032012 CCTTCTGGAGGGTGGATGGTAGG + Intergenic
1132301822 15:100780758-100780780 TCTTCTGTGGAGGGGATGGTTGG - Intergenic
1132584645 16:700891-700913 CCTGCTGAGCGGGGGCTGCCGGG - Intronic
1132905505 16:2280629-2280651 CCTTCTGCGGGGGAGCTGGTGGG + Intronic
1134013858 16:10874816-10874838 CGGTCTGAGGGTGGGATGGGGGG + Intergenic
1134285677 16:12860181-12860203 CCTCCGGAGGGGAGGAAGGCTGG - Intergenic
1135880079 16:26247136-26247158 ACTTCTGAGGGGAGGGAGGCTGG - Intergenic
1139475239 16:67199615-67199637 CCTGCGGAGGGCGGGAGGGCAGG + Intronic
1141694755 16:85614084-85614106 TCTTCTGCGGGGGGGAGGGGAGG - Intronic
1141792102 16:86243829-86243851 CCTGCTGGGCTGGGGATGGCAGG + Intergenic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1143140898 17:4741177-4741199 GCTTCCGAAGGGAGGATGGCTGG - Intronic
1144683602 17:17211592-17211614 CCATCTGAGAGGAAGATGGCTGG - Intronic
1146186894 17:30730029-30730051 GCTTCTGTGAGGGGGATGACAGG + Intergenic
1148124041 17:45227944-45227966 CCTCCTGAGGGGGGCAGGGAGGG - Intronic
1148158318 17:45436056-45436078 CTTTCTGAGGGAGGGGAGGCGGG + Exonic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1148906425 17:50915239-50915261 CCTTCTGGGCTGGGCATGGCAGG + Intergenic
1152300962 17:79495249-79495271 CCTCCTGAAGGGGGGAAGGGAGG + Intronic
1152740880 17:82017852-82017874 CCTACTGAGGTGGGCAGGGCGGG + Intergenic
1152928816 17:83099859-83099881 GGTTCTGAGGGGCGGAAGGCAGG + Intergenic
1153004134 18:482235-482257 CCTTCTGAGGCTGGGATTACAGG + Intronic
1154377348 18:13821266-13821288 CCTGCGGAGGGAGGGATGGGAGG - Intergenic
1156274490 18:35570262-35570284 CCTTTTGAGGGTGGGGTGGGTGG + Intergenic
1160600411 18:80008371-80008393 CCTGCTGTGGGATGGATGGCAGG - Intronic
1161006074 19:1937441-1937463 CATTCTGAGGCCGGGTTGGCTGG - Intergenic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161341527 19:3745787-3745809 CCTCCTGAGGAGTGGGTGGCTGG - Intronic
1161770608 19:6228827-6228849 CCCTCTGAGGGTGGGCTGTCTGG - Intronic
1161812149 19:6477073-6477095 CGTTCTCAGGGATGGATGGCAGG + Exonic
1162639063 19:11993324-11993346 CGTTCTGGAGGGGGGATGTCTGG + Intergenic
1163122386 19:15225823-15225845 CCCTCTGGGGTGGGGATGGGTGG - Intergenic
1163390236 19:17026494-17026516 CCTTCTGGGGTGGGGGTCGCGGG - Intronic
1165330605 19:35139526-35139548 CCCCCTGAGTGGGGGAAGGCAGG + Intronic
1165486650 19:36100704-36100726 CATTCTGAGGCAGGCATGGCTGG - Intronic
1166343098 19:42150390-42150412 CCTGCGGTGGGGGGAATGGCAGG + Intronic
1167250100 19:48394901-48394923 TGTTCTGTTGGGGGGATGGCGGG - Exonic
1167419534 19:49394897-49394919 CCCTGTGATGGGGGGATGACTGG + Intronic
1168452013 19:56474099-56474121 CCTCCTGAGGTGAGGACGGCTGG + Exonic
925101779 2:1253221-1253243 CCTTCTGTGGGGAGGAGGGTGGG - Intronic
925286314 2:2717795-2717817 CCGTCAGAGGAGGGCATGGCAGG - Intergenic
925462469 2:4075320-4075342 CCTTCTGAGTGAGGGCTGTCGGG + Intergenic
926052476 2:9753826-9753848 CCGTCGGAGGGGCGGGTGGCAGG - Intergenic
926509591 2:13758096-13758118 TATTCTGTGGGGGGGATGGGGGG + Intergenic
927007245 2:18863600-18863622 CATTCTGAGGGTGGGATTGGAGG - Intergenic
929896568 2:45966072-45966094 CCTTGGGAGGCGTGGATGGCTGG + Intronic
930219048 2:48727098-48727120 CCTTATGTGGGTGGGATGGAAGG + Intronic
933585512 2:84175667-84175689 ATTTCTGAGGGGGTGATGCCTGG + Intergenic
933688497 2:85161516-85161538 CCTCCTGGGATGGGGATGGCTGG + Intronic
946420798 2:219563414-219563436 CCGTCTGAGGGCTGGGTGGCGGG + Exonic
948676653 2:239600872-239600894 CCTTCAGAGGGGGACATGGATGG + Intergenic
948871841 2:240804524-240804546 CCTGCTGTGGGGGGAATGGGAGG + Intronic
1169267490 20:4175426-4175448 CCCTCTGAGGCGGGCATGGTAGG + Intronic
1171171296 20:23017701-23017723 CCTTCTGAGCGAAGGATGGAGGG - Intergenic
1171275756 20:23855569-23855591 CCCTCTCAGGTGGGGATGGAAGG + Intergenic
1171491162 20:25518340-25518362 CCACCTGAGGAGGGGATTGCTGG + Intronic
1171878258 20:30598154-30598176 CCTTAGGAGGGGAGGAGGGCAGG - Intergenic
1173875974 20:46371776-46371798 CCATCTCAGGGGAGGCTGGCGGG - Intronic
1174039267 20:47687440-47687462 CCTTCTGCTGGGGAAATGGCGGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175953383 20:62595810-62595832 CCTGCTGTGGAGGGGCTGGCGGG + Intergenic
1176138250 20:63534447-63534469 CGTTCTGAGGGAGGGGAGGCAGG - Intronic
1178495343 21:33081329-33081351 CCTGGTGAGGGGGGAATGGGGGG - Intergenic
1178979394 21:37249693-37249715 TTTTTTGAGGGGGAGATGGCGGG + Intronic
1179484191 21:41699253-41699275 CCATCTGAGGGGAAAATGGCAGG - Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179960867 21:44766427-44766449 CCTTCAGAGGGGAAGATGCCCGG + Intergenic
1180788307 22:18559015-18559037 CCTTCTGAGGTGAGGAAGCCCGG + Intergenic
1181233431 22:21436303-21436325 CCTTCTGAGGTGAGGAAGCCCGG - Intronic
1181245219 22:21498540-21498562 CCTTCTGAGGTGAGGAAGCCCGG + Intergenic
1181304133 22:21904855-21904877 CCTCCTGATGGGGGTGTGGCAGG + Intergenic
1182842201 22:33400387-33400409 CCATCTGGGGGAGGGATGGGAGG + Intronic
1183394548 22:37563828-37563850 CCTTCTGAGAGTGGGAGGGCAGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184351467 22:43946729-43946751 CCTTGTGATGGGGGGTAGGCTGG + Exonic
1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG + Intronic
1185074027 22:48673546-48673568 TCTTCTGAGGGTGGGATGGCTGG + Intronic
950054158 3:10011707-10011729 GGCTCTGAGGGGAGGATGGCCGG + Intergenic
950471423 3:13188977-13188999 CCTCCTGAGGGGGTGCTGCCAGG - Intergenic
950522508 3:13505345-13505367 CCTTCTGTGGGGGTGAAGGTGGG + Exonic
950729136 3:14941539-14941561 CTTTCTGGTGGGGGGATGGAGGG + Intergenic
951521768 3:23616929-23616951 CCTTCTGAGGGGATGAAGACAGG + Intergenic
952491455 3:33877977-33877999 CCTGCAGAGGGGATGATGGCTGG + Intergenic
953910953 3:46892807-46892829 CCTTCTGGGGTAGGGATGGAGGG + Intronic
954661144 3:52227555-52227577 CCCTCTGAGAGGTGGATGGAGGG - Intergenic
954793471 3:53149330-53149352 CCTCCTGAGGGGAGGAGGGAAGG - Intergenic
957784218 3:84860359-84860381 CCTCCTGAGGAGGGGAGAGCTGG - Intergenic
957972135 3:87396003-87396025 CCTGCAGAGGGGGTCATGGCAGG + Intergenic
958427590 3:93997061-93997083 CCATCTGGGGGGGTGATGGGAGG - Intronic
960146648 3:114210891-114210913 CCTGTTGAGGGGTGGAGGGCTGG + Intergenic
961294844 3:125876560-125876582 CCAGCTGAGAGGGGGTTGGCAGG - Intergenic
961349063 3:126287529-126287551 CCTTTTGAGCTGGGGCTGGCAGG + Intergenic
961451245 3:127003258-127003280 CCTTCTGTGGGGGGTGGGGCTGG + Intronic
961785571 3:129344709-129344731 GGCTCTGAGGGGAGGATGGCCGG + Intergenic
962134627 3:132721531-132721553 CCTTCTGAGGGGGTGGGCGCGGG + Exonic
962352766 3:134667698-134667720 CCTTCTCAAGGGGTGAGGGCTGG - Intronic
966203258 3:177378919-177378941 GCTTCTGAAGGGGAGAGGGCTGG + Intergenic
967528904 3:190526887-190526909 CCTGCTGAGGGCAGGATGCCAGG - Intronic
968190164 3:196661433-196661455 ACTGCTGTGGGGTGGATGGCTGG + Exonic
968447654 4:660448-660470 CCTTCTGTGGGAGGGATTGTGGG - Exonic
968508921 4:986955-986977 CTTGGTGAGGGGGCGATGGCCGG - Intronic
968652763 4:1766731-1766753 ACCCCTGAGGCGGGGATGGCCGG - Intergenic
968706870 4:2082855-2082877 CCTTCTGAGGGTGTTTTGGCAGG + Intronic
968856238 4:3125890-3125912 CTTTGTGAGTAGGGGATGGCAGG + Intronic
969002451 4:3993031-3993053 CCAGCTGAGAGGGGGTTGGCAGG + Intergenic
969345355 4:6566474-6566496 TCTTCAGAGTGGGGGTTGGCGGG + Intergenic
969532451 4:7737336-7737358 CCATCTGATGAGGGGATGACGGG + Intronic
969551207 4:7868651-7868673 GCATCTGAGGAGGGGCTGGCAGG + Exonic
972553807 4:40160985-40161007 CCTTCTGGGGGTGGGAAGGAGGG - Intergenic
973213593 4:47643814-47643836 CCTTTGGAAGTGGGGATGGCTGG - Intronic
979555852 4:122046643-122046665 CTTTCAGAGTGGGGGATGACAGG - Intergenic
979954536 4:126935677-126935699 CATTTTGTGGGGGGGATGGGAGG - Intergenic
981537932 4:145819729-145819751 CCTTCTGCGGGAGGGATGTGGGG - Intronic
985128111 4:186715122-186715144 CCTTCTGGTGGGGGGATGGAGGG - Intronic
985249102 4:188005361-188005383 CCTTCTGAGGCTGGGAGGGAAGG + Intergenic
985709840 5:1422094-1422116 CCTGCTGAGATGGGGAGGGCAGG - Intronic
986503415 5:8425687-8425709 CCTTCTGCGGGGTGGAGGGTTGG - Intergenic
987118974 5:14748619-14748641 CCATCTGAGGTGGGCATGCCAGG + Intronic
988563307 5:32300072-32300094 CCTTCTCTTGGGGAGATGGCTGG - Intronic
988713782 5:33804380-33804402 CCTTCTGAGGCCAGGTTGGCAGG - Intronic
989188761 5:38649673-38649695 TTTTCTGGGGGGGGGATGGGGGG - Intergenic
990329821 5:54714606-54714628 GGTTCTGAGGGGGTGGTGGCAGG + Intergenic
994682111 5:102901219-102901241 CCTTCTGAGGGCTGAGTGGCAGG - Intronic
996212064 5:120823201-120823223 CCTTCTGTGTGCCGGATGGCAGG - Intergenic
996815075 5:127565521-127565543 CCGTGTGAGGTGGGGCTGGCTGG + Intergenic
997426442 5:133805940-133805962 CCTTCTGATCGGGGGTTGGGGGG - Intergenic
997466679 5:134092764-134092786 CCTTCTGTGTGGGGCATCGCTGG - Intergenic
998341734 5:141423409-141423431 GCTTCTGAAGGCGGGTTGGCAGG + Exonic
1001706364 5:173743945-173743967 CCTTCTGAGAGAGGGGAGGCAGG - Intergenic
1001993369 5:176134863-176134885 CCTGCTGAGGGGGAGGTGGTGGG + Intergenic
1002188617 5:177467668-177467690 CGTGCTGGGGTGGGGATGGCGGG - Intronic
1002375577 5:178786641-178786663 CTTCCAGAGGCGGGGATGGCTGG + Intergenic
1003138930 6:3455986-3456008 CCTTGTCCGGAGGGGATGGCAGG + Exonic
1004078274 6:12365460-12365482 CCTTCTGGGTGGGGGCTGGAAGG + Intergenic
1005962247 6:30702612-30702634 CCATCTGAGGTGGTGGTGGCTGG + Exonic
1006337365 6:33427752-33427774 CCTGCTCAGGAGGGGATGGTGGG + Intronic
1006438594 6:34039894-34039916 CCCACTGAGGAGGGGATGGGGGG - Intronic
1007395147 6:41573466-41573488 ACTTCTGAATGGGGGATGGGGGG + Intronic
1007574445 6:42916055-42916077 CCTTCCGAGTGGGCCATGGCCGG + Exonic
1007851107 6:44803667-44803689 ACTGCTGAGTGGGGCATGGCAGG + Intergenic
1010464518 6:76151279-76151301 TCTTCTGAGGCAGGGACGGCTGG + Intergenic
1012637946 6:101570489-101570511 CCTTCAGAGAGGGAGCTGGCAGG - Intronic
1012827200 6:104161939-104161961 CCTTTTGAGGGGGTGATCACTGG - Intergenic
1013252451 6:108347979-108348001 CGTTATGAGGGAGTGATGGCAGG + Intronic
1013276629 6:108591447-108591469 CCTTCTGATGGTGGGGTAGCTGG + Intronic
1015717240 6:136205461-136205483 CCATCTGCAGGGGGGATGGTGGG - Intergenic
1016845429 6:148564139-148564161 CCATCAGAGTGGGGAATGGCAGG + Intergenic
1017728209 6:157290803-157290825 CCTGCAGAGGGGAGGCTGGCAGG - Exonic
1019295575 7:272307-272329 CCTTCTGTGGGGGAGAGTGCGGG - Intergenic
1019571201 7:1713285-1713307 CCTTCTGAGGTGGGCCGGGCTGG - Intronic
1020250274 7:6462363-6462385 CCATCTGAGTGTGGGATGGGAGG - Exonic
1020321452 7:6941484-6941506 CCAGCTGAGAGGGGGTTGGCAGG + Intergenic
1022534514 7:31087496-31087518 CTCTCTGAGGAGGGGCTGGCTGG - Intronic
1023987467 7:45105132-45105154 TCTTGAGAGGGGGGCATGGCAGG - Intronic
1027995402 7:85419425-85419447 CCTTCTCCGGGGGGGAGGGGGGG - Intergenic
1029736744 7:102469453-102469475 CCCTCCGAGGCGGGGAGGGCGGG - Intronic
1030135458 7:106243085-106243107 GCATGTGAGGTGGGGATGGCAGG + Intergenic
1030262550 7:107580447-107580469 CCTTCTGGGAGCGGGAGGGCCGG + Intronic
1030634038 7:111927849-111927871 CCTGCTCAGGGGAGAATGGCAGG - Intronic
1031299926 7:120052901-120052923 ACTTCTGAAAGGGGGTTGGCTGG + Intergenic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1034983143 7:155491046-155491068 CCTTCTCACGGAGGGAGGGCCGG - Intronic
1036933553 8:12979122-12979144 CCCTCTGGCGGGGGAATGGCAGG + Intronic
1037913273 8:22756980-22757002 CCTTCTGCAGTGGGGATAGCTGG - Intronic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1045062778 8:98423590-98423612 GCTGCTGTGGGGAGGATGGCTGG + Intronic
1048502602 8:134992401-134992423 CTTTCTGAGGAGGGAAAGGCTGG + Intergenic
1048955087 8:139529291-139529313 ACTTCTGTTGGGGGGTTGGCAGG + Intergenic
1049204996 8:141359519-141359541 CCTTGTGTGGTGGGGGTGGCAGG - Intronic
1052852402 9:33386025-33386047 CGTCCTGAGGGGTGGAGGGCAGG + Intronic
1053680501 9:40482576-40482598 CGTCCTGAGGGGTGGAGGGCAGG + Intergenic
1053930490 9:43110887-43110909 CGTCCTGAGGGGTGGAGGGCAGG + Intergenic
1054283211 9:63142359-63142381 CGTCCTGAGGGGTGGAGGGCAGG - Intergenic
1054293586 9:63318091-63318113 CGTCCTGAGGGGTGGAGGGCAGG + Intergenic
1054391608 9:64622580-64622602 CGTCCTGAGGGGTGGAGGGCAGG + Intergenic
1054504120 9:65893748-65893770 CGTCCTGAGGGGTGGAGGGCAGG - Intronic
1055029089 9:71754056-71754078 CCTGTTGAGGGGTGGAGGGCTGG + Intronic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057582946 9:96303588-96303610 CCTTCTGGGGGTGGGATGGAGGG + Intergenic
1059749338 9:117233133-117233155 CCTTCTGAGGGGCAGAGAGCAGG + Intronic
1059827459 9:118047214-118047236 CCTTTTGAGGGGTGGAGGGTGGG - Intergenic
1061588409 9:131583220-131583242 CCTTCTGAGTGGGGCAGGGCTGG - Intronic
1061733551 9:132636028-132636050 CCTTCTGGGGGAGTGATGGTGGG - Intronic
1061929217 9:133823935-133823957 CCTTCTCAGTGGGAGATCGCAGG - Intronic
1062318227 9:135978450-135978472 GCTGCTGAGGAGGGGATGGGGGG - Intergenic
1062318284 9:135978610-135978632 GCTGCTGAGGCGGGGATGGAGGG - Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1187385522 X:18845028-18845050 CCTCCTCAGGCAGGGATGGCAGG - Intergenic
1189840666 X:45073020-45073042 CCTGCTGTGGGGTGGAAGGCAGG - Intronic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1191144829 X:57155068-57155090 CCTGCTGCTGTGGGGATGGCAGG + Intergenic
1192534122 X:71912908-71912930 CTTTCTGTGGGAGGGAAGGCAGG + Intergenic
1194583414 X:95704630-95704652 CTTTGTGAGGGGGGGTTGGGAGG - Intergenic
1195589816 X:106611779-106611801 CCGTCTGGGGGAGGGATGACAGG - Intergenic
1197079790 X:122398358-122398380 CCTGCTGTGGTGGGGGTGGCAGG - Intergenic
1199382330 X:147184438-147184460 CCTTCTGAGGGGGACAGAGCAGG + Intergenic
1200179408 X:154141189-154141211 CCTTCTGAGGGTGGGATGGCTGG - Intergenic
1200249177 X:154543121-154543143 CCTGCTGTGGGGGAGATGGGAGG - Intronic