ID: 1179575682

View in Genome Browser
Species Human (GRCh38)
Location 21:42306949-42306971
Sequence TCTGTGACGCTGGGAGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179575671_1179575682 28 Left 1179575671 21:42306898-42306920 CCAGGGGGCCGGGTGGTCACAGC No data
Right 1179575682 21:42306949-42306971 TCTGTGACGCTGGGAGCTCTGGG No data
1179575677_1179575682 0 Left 1179575677 21:42306926-42306948 CCACAGCTGGGCAACCTATAATC No data
Right 1179575682 21:42306949-42306971 TCTGTGACGCTGGGAGCTCTGGG No data
1179575674_1179575682 20 Left 1179575674 21:42306906-42306928 CCGGGTGGTCACAGCAGGGACCA No data
Right 1179575682 21:42306949-42306971 TCTGTGACGCTGGGAGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179575682 Original CRISPR TCTGTGACGCTGGGAGCTCT GGG Intergenic