ID: 1179576911

View in Genome Browser
Species Human (GRCh38)
Location 21:42313530-42313552
Sequence TGGAGTCAAAGCAGCAGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179576903_1179576911 16 Left 1179576903 21:42313491-42313513 CCTGCAGGGGCTTGAAACACCAA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1179576911 21:42313530-42313552 TGGAGTCAAAGCAGCAGCCCCGG 0: 1
1: 0
2: 2
3: 27
4: 280
1179576902_1179576911 23 Left 1179576902 21:42313484-42313506 CCTGCTTCCTGCAGGGGCTTGAA 0: 1
1: 0
2: 1
3: 18
4: 228
Right 1179576911 21:42313530-42313552 TGGAGTCAAAGCAGCAGCCCCGG 0: 1
1: 0
2: 2
3: 27
4: 280
1179576901_1179576911 28 Left 1179576901 21:42313479-42313501 CCTTACCTGCTTCCTGCAGGGGC 0: 1
1: 0
2: 5
3: 34
4: 352
Right 1179576911 21:42313530-42313552 TGGAGTCAAAGCAGCAGCCCCGG 0: 1
1: 0
2: 2
3: 27
4: 280
1179576907_1179576911 -3 Left 1179576907 21:42313510-42313532 CCAAGGCACTCCAGGGATCCTGG 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1179576911 21:42313530-42313552 TGGAGTCAAAGCAGCAGCCCCGG 0: 1
1: 0
2: 2
3: 27
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179576911 Original CRISPR TGGAGTCAAAGCAGCAGCCC CGG Exonic
900889777 1:5441538-5441560 AGGAGACTCAGCAGCAGCCCTGG + Intergenic
900912645 1:5612489-5612511 CCTAGTCAAAGCAGCAGCCAGGG + Intergenic
901647325 1:10723664-10723686 GGGCATCAAATCAGCAGCCCTGG + Intronic
902090436 1:13898643-13898665 TGGCATCAGAGCTGCAGCCCAGG - Intergenic
902303106 1:15516867-15516889 TGGAGACAGGGCTGCAGCCCGGG - Intronic
902398544 1:16145209-16145231 TGGAGACAAAGCAGCCCCCGGGG + Intronic
902911040 1:19597296-19597318 AGGAGCCGGAGCAGCAGCCCGGG + Intronic
903257344 1:22111732-22111754 TGAATTCATAGCAGCAGCCCTGG + Intergenic
904294285 1:29507672-29507694 TGGACTAAAAGCACCAGCGCTGG - Intergenic
904374230 1:30069731-30069753 TGGGGTCACAGGAACAGCCCTGG - Intergenic
904441937 1:30537650-30537672 TGGGGTGGAAGCAGCAGCCTAGG - Intergenic
904789125 1:33005242-33005264 TGGAGTAGAATCAGCATCCCTGG + Intergenic
905111305 1:35596569-35596591 TGGAGTTCAGGCAGCAGCCTGGG - Intergenic
907256753 1:53185128-53185150 TGGAAGCGAAGCAGCAGCTCCGG + Intergenic
907929875 1:58989401-58989423 TGGAGCCATAGCAGCTTCCCTGG - Intergenic
909232335 1:73106146-73106168 AAGAGTCAAAGCTGGAGCCCAGG - Intergenic
912070012 1:105797515-105797537 TAGAGTTAAAGGAGCATCCCAGG + Intergenic
912388121 1:109282827-109282849 TGGAGGCAAAGCAAGCGCCCAGG + Intronic
913075481 1:115337922-115337944 TGCAGTCCAGGGAGCAGCCCTGG - Intronic
914764955 1:150629549-150629571 AGGAGCCGAAGCAGCAGCGCAGG - Exonic
914812911 1:151042503-151042525 TAGAGTCAAAACAGAAGCCTGGG + Intronic
915118566 1:153614968-153614990 TAGAGTCATTGCAGCTGCCCAGG + Exonic
915648145 1:157288549-157288571 TTGTGTCAAAACACCAGCCCTGG + Intergenic
916237963 1:162609446-162609468 TGGAGTCAAGCCATCAGCCAAGG + Intergenic
918118110 1:181514474-181514496 AGGGGTCAAAACACCAGCCCTGG - Intronic
919869879 1:201812301-201812323 GGAACTCAGAGCAGCAGCCCTGG - Intronic
922085956 1:222347083-222347105 TGGTGCCAAAGAAGCTGCCCTGG - Intergenic
922744528 1:228036811-228036833 TGCAGTGGATGCAGCAGCCCAGG + Intronic
923435835 1:233966859-233966881 TGGAGGCAAAGCATCAGTGCTGG + Intronic
923454004 1:234147027-234147049 AGGAGTCACAGTAGCAGCACTGG - Intronic
924604047 1:245516939-245516961 GGGGGTGAAAGCAGCAGCCGTGG - Intronic
1064031766 10:11887289-11887311 TGAAGCCAAAGTAGAAGCCCTGG + Intergenic
1065618260 10:27551144-27551166 TGCACCCAGAGCAGCAGCCCAGG - Intergenic
1065804604 10:29383023-29383045 AGGAGTCACAGCAGGAGACCAGG + Intergenic
1065944529 10:30594709-30594731 AGGAGTCACAGCAGGAGACCAGG - Intergenic
1067382253 10:45785746-45785768 TGAAGACAAAGCTGTAGCCCTGG - Intronic
1067889948 10:50126294-50126316 TGAAGACAAAGCGGTAGCCCTGG - Intronic
1071384670 10:85107213-85107235 AGGAGTCAGAGCTACAGCCCTGG + Intergenic
1072158389 10:92744296-92744318 TGAAGGGAAAGCAGCAGCCCAGG - Intergenic
1072199220 10:93143772-93143794 TAGAGTAAAAGCAGCATTCCAGG + Intergenic
1072532565 10:96332877-96332899 TGGAATCAAATCAGCATCTCTGG + Intronic
1074139744 10:110661415-110661437 TGGAGGGAGAGCAGCAGGCCTGG + Intronic
1074427588 10:113365769-113365791 TGGAGTCAAAGTGTCAGCCAGGG + Intergenic
1074471699 10:113733007-113733029 TGGACAAATAGCAGCAGCCCAGG + Intergenic
1074979999 10:118611756-118611778 TGTAGTGAGAGCAGCAGGCCAGG + Intergenic
1076021285 10:127076109-127076131 TTGAGTCAAATCAGCATCCAAGG + Intronic
1076285801 10:129295287-129295309 TGCAGTTAAATCAGCAGCCATGG - Intergenic
1076727413 10:132420040-132420062 AGGAGGGACAGCAGCAGCCCTGG - Intergenic
1077400254 11:2352118-2352140 TGGAGTCAAGGGAGGAACCCAGG - Intergenic
1077721958 11:4638498-4638520 TGGAGTAACAGCAGCAGCACTGG + Intergenic
1078184167 11:9037614-9037636 CTGGGACAAAGCAGCAGCCCTGG - Intronic
1079160633 11:17990065-17990087 TGCAGTGAAAGCAGAAGACCTGG - Intronic
1079283174 11:19106214-19106236 TGTGGTCAAAGCACCAGCCCAGG + Intergenic
1080621141 11:33988107-33988129 TGTATTCAAAGCACAAGCCCTGG + Intergenic
1081537869 11:44008355-44008377 TGCAGTCCAGGCACCAGCCCCGG - Intergenic
1081667278 11:44923877-44923899 TGGACTCAACCAAGCAGCCCAGG - Intronic
1081744261 11:45462033-45462055 TGCTGTGAATGCAGCAGCCCTGG + Intergenic
1083365484 11:62139353-62139375 GGGAGGCAAAGCAGGAGGCCAGG - Intronic
1083414139 11:62514355-62514377 TTGAGTGAAAGCAGCACCCCGGG + Intronic
1083934946 11:65865276-65865298 TGGGGAGAAGGCAGCAGCCCTGG + Exonic
1084376888 11:68783721-68783743 TGGATGCTGAGCAGCAGCCCTGG - Intronic
1084384329 11:68833200-68833222 TGGAAGGACAGCAGCAGCCCAGG + Intronic
1084461594 11:69299403-69299425 TGGAGACAGAACAGCAGTCCCGG + Intronic
1084486221 11:69449815-69449837 TGGGGACAGAGCAGCAGCTCAGG - Intergenic
1084579507 11:70014326-70014348 TGGAGGCAAAGGAGCGGCTCAGG - Intergenic
1085242653 11:75071500-75071522 TGGTGTCAGAGCAGGAGGCCTGG + Intergenic
1085244505 11:75089122-75089144 TGGTGTCAGAGCAGGAGGCCTGG + Exonic
1085619311 11:78025700-78025722 TGTACTCCAAGCAGCTGCCCTGG - Intronic
1085786515 11:79456406-79456428 TGCAGTCAAAGCAGCAGAGAAGG - Intergenic
1086439621 11:86815133-86815155 TAGAATCCAAGCAGCAGCCGTGG + Intronic
1087848255 11:102997992-102998014 TTCACTCAATGCAGCAGCCCAGG + Intergenic
1088420172 11:109636359-109636381 TGGAGTCACAGCAGCTGATCTGG + Intergenic
1089711969 11:120321982-120322004 AGGACTCAAAGCAGGAACCCTGG + Intergenic
1089751434 11:120654155-120654177 TGTAGTCAAAGCAGGGGCCTGGG + Intronic
1091322653 11:134663071-134663093 GAGAGTAAAAGCTGCAGCCCTGG + Intergenic
1091657213 12:2354421-2354443 TGCAGTCATAGCTGCAGCCCTGG - Intronic
1092734158 12:11563994-11564016 TGGAGTCAATGTATCAGCCTTGG + Intergenic
1093853263 12:24067183-24067205 TGGAGGCTAAGCAGAAGCCAGGG + Intergenic
1096859632 12:54515916-54515938 AGGAGTCAAGGCAGGAGCACAGG + Intronic
1097070474 12:56350871-56350893 TGGAGTCTCACCAGCAGCCTGGG + Exonic
1101541841 12:105672467-105672489 AAGAGTCACGGCAGCAGCCCTGG - Intergenic
1101760030 12:107650971-107650993 TGAATACAAAGCAGCTGCCCGGG + Intronic
1101873115 12:108581634-108581656 TGGAGTCAGGCCCGCAGCCCTGG - Intergenic
1103143368 12:118571811-118571833 TGTCGTGAAACCAGCAGCCCTGG - Intergenic
1104755926 12:131269349-131269371 GGGAGTCAACGCAGGAGCCCGGG - Intergenic
1104775247 12:131387054-131387076 TGGGGTCAGAGCAGCCGCCCTGG + Intergenic
1104777786 12:131401332-131401354 GGGAGTCGACGCAGGAGCCCGGG + Intergenic
1105338024 13:19492869-19492891 TGAATTTAAAGGAGCAGCCCTGG - Exonic
1110134528 13:72048905-72048927 TGGAGTCAAAGATGAAGCTCAGG + Intergenic
1112092356 13:96094740-96094762 TGGATTCAAACCACCAGCCCGGG - Intronic
1113905589 13:113817824-113817846 TGGAGGCAGAGCAGAAACCCAGG + Intergenic
1115447285 14:33505830-33505852 TGAAGTCAGAGAAGCAGCCTGGG - Intronic
1117914729 14:60665417-60665439 AGTAGCCAAAGCAGCTGCCCAGG + Intergenic
1118337413 14:64865799-64865821 TAGAATCAAAGCAGCTGCTCTGG - Intronic
1120299957 14:82693134-82693156 AGGAGCCGAAGCAGCAGCGCAGG - Intergenic
1120451340 14:84670771-84670793 TGGAGTCAAATCAGAAACACAGG - Intergenic
1121871913 14:97415924-97415946 TGCACACAAAGCAGCATCCCAGG - Intergenic
1121952934 14:98187696-98187718 TGGAGTCACGGCTGGAGCCCAGG + Intergenic
1122078017 14:99247977-99247999 TGGAGAAAAGGCAGCAGCCAAGG - Intronic
1122854318 14:104552897-104552919 TGGGCCCCAAGCAGCAGCCCTGG + Intronic
1202888386 14_KI270722v1_random:131059-131081 TCAAGTCAAAGCATCAGCCCAGG - Intergenic
1124439836 15:29677883-29677905 TGGAGTCATGGCTGCAGGCCAGG + Intergenic
1125410952 15:39405663-39405685 TCGAGTCATTGCAGGAGCCCTGG + Intergenic
1127076091 15:55327056-55327078 TGGATTCAAGGCTGCAGCCTGGG + Intronic
1128736136 15:70055017-70055039 TGGAGGCGGCGCAGCAGCCCTGG + Intronic
1130382306 15:83380820-83380842 TGGCTTCACAGCAGCAGACCTGG + Intergenic
1131500926 15:92965469-92965491 TGGCGTCAACCCAGGAGCCCAGG + Intronic
1132839877 16:1973782-1973804 TGGAGTCAGCCCAACAGCCCAGG - Intronic
1132995033 16:2818336-2818358 TGGAGTCCACACAGCGGCCCGGG - Intronic
1133036292 16:3036072-3036094 TGGAGTCAAAGCACCTGCTCAGG - Intronic
1133144078 16:3770680-3770702 TACAGTCCAGGCAGCAGCCCAGG - Exonic
1133769712 16:8860695-8860717 GGGAGGGACAGCAGCAGCCCTGG + Intronic
1134012562 16:10866258-10866280 TGGAGTCAGGGCAGCTGCCCTGG - Intergenic
1134146674 16:11770317-11770339 TAAAGTTAAAGCAGCAGCCACGG + Intronic
1134879017 16:17728085-17728107 TGGAGGCAAAGCTGAAGCCAAGG + Intergenic
1135733787 16:24915108-24915130 TGCAGTCAAGGCAGCAGCCAGGG - Intergenic
1135874748 16:26187945-26187967 GGGATGCAAAGCAGCATCCCTGG + Intergenic
1139736072 16:68989841-68989863 TAGACTCAAAGCAGCAGCTAAGG - Intronic
1142496885 17:310654-310676 TGGGGTTAAGGCGGCAGCCCTGG - Intronic
1143574411 17:7782060-7782082 GGGAGTAAAAGCAGGAACCCTGG + Intronic
1146931262 17:36779838-36779860 TGGCGTCACAGAAGCAGCGCTGG - Intergenic
1148000574 17:44384978-44385000 TGGAGTCAAAGGAGAGGCTCTGG + Exonic
1148028042 17:44601746-44601768 TTGAGTCAGAGGAGGAGCCCTGG - Intergenic
1151731456 17:75913973-75913995 TGCAGGCAGAGCAGCAGGCCCGG - Exonic
1152826621 17:82470152-82470174 TGAAGTCTAAGCAGCAGCCTGGG + Intronic
1153304818 18:3621995-3622017 TGTTGGCAAAGCAGCAGCCCAGG - Intronic
1156487718 18:37477217-37477239 TGGAGTTAATGGAGCAGCCTGGG + Intronic
1158890397 18:61866756-61866778 TGACCTCAAAGCAGCAGCTCTGG + Intronic
1160073393 18:75648486-75648508 TGGAGTAATAGCAGGAACCCTGG + Intergenic
1163404998 19:17116595-17116617 TGGAGACAAACCAGCAGGCCTGG + Intronic
1163485051 19:17580539-17580561 TGGAGTGAATGCAGGAGCCCAGG - Intronic
1163650464 19:18514887-18514909 TGGGCTCGAAGCAGCTGCCCAGG - Intronic
1165057530 19:33187465-33187487 TGAAGTCAAAGCAGCAACCCCGG + Intronic
1166944977 19:46390869-46390891 TGGAGCCGAAGGAGCTGCCCGGG + Intronic
1202663782 1_KI270708v1_random:97851-97873 TCAAGTCAAAGCATCAGCCCAGG - Intergenic
926616709 2:15003016-15003038 TGCAGCCAAAGTAGGAGCCCAGG + Intergenic
927087768 2:19688357-19688379 TGGAGTGCCAGCAGTAGCCCAGG + Intergenic
927313970 2:21660789-21660811 TAGAGTCAATGCAGGAGCTCAGG - Intergenic
929377922 2:41313280-41313302 TGAAATTAAAGCTGCAGCCCTGG - Intergenic
929996392 2:46828767-46828789 TAGGGACAAAGCAGGAGCCCAGG + Intronic
934912749 2:98274518-98274540 TGGAGTGAAAGAAACAGCCTGGG + Intronic
935452110 2:103221858-103221880 TGAAGTCAAAAAAGAAGCCCTGG - Intergenic
937886923 2:126906161-126906183 TGCAGTCTAGGCAGCAGCCTAGG - Intergenic
938595223 2:132782302-132782324 TGGAAGCAAAGCAGAAGCCTGGG - Exonic
938701620 2:133885032-133885054 TGTAGTCAAAGCAGCAGCCATGG + Intergenic
940746631 2:157574876-157574898 TGGAGTTATAGCAGCTGCCTTGG - Intronic
944277497 2:197855543-197855565 TAGAATCCAAGCAGGAGCCCAGG - Intronic
944695178 2:202194237-202194259 AGGAGAGAAAGCAGCAGCTCCGG + Exonic
945049276 2:205807769-205807791 TAGACTCCAATCAGCAGCCCAGG + Intergenic
945823914 2:214697625-214697647 AGGAGCCAAAGCAGCAGCATAGG + Intergenic
946588702 2:221219321-221219343 TGGAGACAAAGCACTAGCACTGG + Intergenic
946692537 2:222320007-222320029 CAGAGCCCAAGCAGCAGCCCCGG - Intergenic
947827337 2:233115280-233115302 TGCAGGCAGAGCAGGAGCCCCGG - Intronic
948020959 2:234732865-234732887 TGGAGTCCAAGCCTCACCCCAGG + Intergenic
1168997680 20:2145169-2145191 TGGGCTCAGAGCAGCAGCCCAGG - Exonic
1169461271 20:5797843-5797865 TAGAGCCTAAGCAGTAGCCCAGG - Intronic
1171088968 20:22266458-22266480 TGGGGTCACCTCAGCAGCCCAGG + Intergenic
1171133386 20:22675601-22675623 TGGTTTGATAGCAGCAGCCCGGG - Intergenic
1171251689 20:23653670-23653692 AGGAGTTAAAGCAGAAACCCTGG - Intergenic
1172510536 20:35497909-35497931 TGGCCGCAGAGCAGCAGCCCGGG + Exonic
1172883480 20:38216563-38216585 TGGGGACAAAGGAGCAGCCTGGG - Intronic
1172938941 20:38641434-38641456 TGCAGTCCAGGCTGCAGCCCAGG - Intronic
1173569333 20:44066588-44066610 TGGGAGCAAGGCAGCAGCCCTGG + Intronic
1173860497 20:46280122-46280144 TGGGGTAAAAACAACAGCCCGGG + Intronic
1174423528 20:50416220-50416242 CAGAGTCAAAGCCCCAGCCCAGG - Intergenic
1174490809 20:50893696-50893718 TGGAGTCAAATCTGTAGGCCAGG - Exonic
1175088309 20:56480045-56480067 TGGATTCAAAGCATCAGGACAGG - Intronic
1175239982 20:57539939-57539961 TGCAGTCAAAGCACCATCCTAGG - Intergenic
1175848141 20:62069855-62069877 TGAAGTTAAGTCAGCAGCCCAGG + Intergenic
1176429685 21:6568050-6568072 TGGAGTCTGAGCAGCTGCCAAGG + Intergenic
1176735603 21:10543341-10543363 TGAATTTAAAGGAGCAGCCCGGG + Exonic
1177225196 21:18244928-18244950 TAGAGGCGAAGCAGAAGCCCCGG - Exonic
1178163051 21:29940415-29940437 CAGAGTCAAAACAGGAGCCCCGG - Intergenic
1178414025 21:32389293-32389315 TGAAGTCAAAGAAGCAGGCAGGG + Intronic
1179291473 21:40021557-40021579 GGAAGTCAAAGCAGCTGCCTGGG - Intronic
1179576911 21:42313530-42313552 TGGAGTCAAAGCAGCAGCCCCGG + Exonic
1179705079 21:43175512-43175534 TGGAGTCTGAGCAGCTGCCAAGG + Intergenic
1179714880 21:43281502-43281524 CTGAGTCAAAGCACAAGCCCAGG - Intergenic
1180330505 22:11474735-11474757 TCAAGTCAAAGCATCAGCCCAGG - Intergenic
1180873750 22:19164076-19164098 GGGAGCCACAGCAGCAGGCCAGG + Intergenic
1182686891 22:32128099-32128121 TGCGGGCAGAGCAGCAGCCCAGG - Intergenic
1182714720 22:32348370-32348392 TGAGGGCAGAGCAGCAGCCCAGG + Intergenic
1183150780 22:36035599-36035621 TGGAGTCAAAGGACCAGGACTGG + Intergenic
1183352265 22:37340927-37340949 TGGTTTCAAAGCTGCAGTCCCGG - Intergenic
1183533600 22:38380389-38380411 TGAATTTAAAGGAGCAGCCCTGG - Intronic
1184088666 22:42281171-42281193 TGGAGTCTCAGGACCAGCCCAGG - Intronic
1184350034 22:43937415-43937437 GGGAGTGATGGCAGCAGCCCAGG - Intronic
1185066845 22:48636714-48636736 AGGCTTCACAGCAGCAGCCCTGG - Intronic
1185383988 22:50523251-50523273 TGGAGATAACCCAGCAGCCCGGG + Exonic
950686378 3:14621475-14621497 TGAAATCAAATCAGCAGGCCTGG + Intergenic
950705523 3:14777572-14777594 TGCAGCAACAGCAGCAGCCCAGG + Intergenic
950772582 3:15324022-15324044 TGGGGGCAGTGCAGCAGCCCTGG + Intronic
951136135 3:19106596-19106618 GGGAGTCACAGCACCAGCTCAGG + Intergenic
952279680 3:31910978-31911000 AAGAATCAAAGCAACAGCCCAGG - Intronic
952888867 3:38028327-38028349 TGGTGTAAAAGCAACAGCTCTGG + Intronic
953033123 3:39190841-39190863 TGGCCTCAGAACAGCAGCCCTGG + Intronic
953493291 3:43367051-43367073 TGGGGTCAAAGCCGCTGGCCAGG - Intronic
955498695 3:59562915-59562937 TGGAGTCAAAGCAGCCCGCTTGG - Intergenic
957598907 3:82306463-82306485 TAGAGTAAAGGCAGCCGCCCAGG + Intergenic
963071835 3:141311233-141311255 TGAAGGCTGAGCAGCAGCCCAGG - Intergenic
964378462 3:156073040-156073062 TGCTGCCAAAGCAGGAGCCCAGG - Intronic
964415596 3:156444529-156444551 TGGAGTCAGAACTCCAGCCCAGG + Intronic
964893331 3:161562928-161562950 TTGAGAAGAAGCAGCAGCCCTGG + Intergenic
967307797 3:188075947-188075969 TGGTGTCACAGCAGAAGCCCAGG + Intergenic
969005007 4:4011953-4011975 TGGAGTGAAGGCAGGACCCCTGG + Intergenic
969650569 4:8465408-8465430 TGAAGTCAAAGAAGCAGCAGGGG - Exonic
970613265 4:17744988-17745010 TTGAGGAAAAGCAGCAGCTCCGG - Intronic
970754624 4:19410303-19410325 GGCAGTCAAAGCAGCAGAACAGG - Intergenic
974781818 4:66561962-66561984 TGCCGCCAAAGCAGGAGCCCAGG + Intergenic
975131938 4:70839770-70839792 TGCAGTTACAGCCGCAGCCCCGG + Exonic
975841083 4:78474972-78474994 TGGAGTCAGAGCAGAAGCAGAGG - Intronic
978955606 4:114608939-114608961 TTAAATCAAAGCACCAGCCCAGG + Intronic
982041022 4:151396772-151396794 TAGAGATAGAGCAGCAGCCCAGG - Intergenic
982812551 4:159844276-159844298 TGGAGGAAAAGCAGGAGCCTGGG - Intergenic
984889360 4:184477144-184477166 GGGAGTCCAAGCAGGAGACCAGG - Intergenic
985538808 5:478468-478490 GGGAGAGAAAGCAGCCGCCCTGG + Intronic
985894630 5:2740939-2740961 TGGGGTCAAGGCAGCATCCTGGG - Intergenic
988708825 5:33753500-33753522 TGGAAACAAAGCAGAAGTCCAGG + Intronic
991481478 5:67085724-67085746 TAGAGTCGAAACAGCTGCCCAGG + Intronic
994322341 5:98407825-98407847 GGGAGTCATAGCAATAGCCCAGG - Intergenic
995975313 5:118028701-118028723 TGGAGTCAAACTAGAATCCCGGG - Intergenic
997810393 5:136962201-136962223 TGAAGTAAAAGCAGCAATCCTGG + Intergenic
998869558 5:146538516-146538538 TGGAGTCACCGTATCAGCCCTGG - Intergenic
999082397 5:148856645-148856667 TGGAGTCAGGGCAGCTGCACAGG + Intergenic
1000413920 5:160963637-160963659 TGGAGTCAAACTAACAGTCCTGG + Intergenic
1001397252 5:171426278-171426300 TGACGACAAGGCAGCAGCCCTGG - Intronic
1002841706 6:912069-912091 AGGATGCAAAGCAGGAGCCCGGG - Intergenic
1004179385 6:13367832-13367854 GGGAGTCAAAGCACCTGTCCTGG + Intronic
1004424422 6:15497752-15497774 TGGAGTTAAAGCAGGGGCCGGGG + Intronic
1006238849 6:32660231-32660253 AGGAGTCAGTGCAGAAGCCCTGG + Exonic
1006465203 6:34189827-34189849 TGGACTCAATGCAGCCGCCCAGG + Intergenic
1006804442 6:36779033-36779055 AGGAGTCCAGGCACCAGCCCTGG + Intronic
1007424091 6:41735585-41735607 TGGAGTGACAGCCGGAGCCCGGG - Intronic
1008597550 6:53058291-53058313 AGAAGTAAAAGCAGCAGCTCAGG - Intronic
1012521599 6:100127499-100127521 TGGAGACATACTAGCAGCCCTGG + Intergenic
1012929515 6:105302498-105302520 TGAAGACCAAGCAGCAGCCGCGG - Intronic
1013773649 6:113654452-113654474 TGGAGTCAAAGAGGCAGTCTTGG - Intergenic
1015132258 6:129826147-129826169 TGGAGTCAAAGCACATGCCAAGG + Intergenic
1017193968 6:151680994-151681016 AGGAGGCCAAGCAGCAGGCCAGG - Intronic
1018782072 6:167077201-167077223 TGGAGACAAAGCACCTGGCCTGG + Intergenic
1019213803 6:170427102-170427124 TGGAACCAGACCAGCAGCCCAGG - Intergenic
1019366347 7:635387-635409 AGGGGTCAGAGCAGCAGGCCTGG + Intronic
1019435787 7:1021473-1021495 TCTTGTCAAAGCAGCAGCCCAGG - Intronic
1020091699 7:5345590-5345612 TGGAGGCCAAGCAGAAGGCCCGG - Exonic
1021929142 7:25562233-25562255 TGTAGTAAAAGCTGCAGCCAAGG + Intergenic
1023004834 7:35853140-35853162 TGCAGTAAAAGCAGTGGCCCTGG + Intronic
1024359605 7:48454737-48454759 AGGAAGCAAAGGAGCAGCCCAGG + Intronic
1024700703 7:51901375-51901397 TGCAGTCAAAGTGGGAGCCCAGG + Intergenic
1025218526 7:57082548-57082570 TGCAGTAAAAGCAGTGGCCCTGG - Intergenic
1025629450 7:63256165-63256187 TGCAGTAAAAGCAGTGGCCCTGG - Intergenic
1025652821 7:63487914-63487936 TGCAGTAAAAGCAGTGGCCCTGG + Intergenic
1026529215 7:71182870-71182892 TTGAGTCCAAACAGCAGCCTGGG - Intronic
1026620077 7:71942434-71942456 TGGAGTCAGAGCAAGAGGCCTGG + Intronic
1026742242 7:72986135-72986157 TGGTGTCTAAGCAGGAGCCATGG - Intergenic
1026802090 7:73406555-73406577 TGGTGTCTAAGCAGGAGCCATGG - Intergenic
1026899643 7:74029693-74029715 GGGCCTGAAAGCAGCAGCCCCGG + Intronic
1027028366 7:74870874-74870896 TGGTGTCTAAGCAGGAGCCATGG - Intergenic
1027050565 7:75018915-75018937 GGGACTGAAAGCAGCAGCTCTGG - Intronic
1027101493 7:75378943-75378965 TGGTGTCTAAGCAGGAGCCATGG + Intergenic
1027371912 7:77515245-77515267 TGTAGTCAAAATATCAGCCCTGG + Intergenic
1028925899 7:96356892-96356914 TGGACTCAAGGCAGAAGCCTAGG + Intergenic
1029284041 7:99454071-99454093 CAGAGTCAAAACAGCAGCGCGGG + Exonic
1029382485 7:100222755-100222777 GGGACTGAAAGCAGCAGCTCTGG + Intronic
1030198231 7:106874779-106874801 TGGACTGAAAGCAGGAGCGCTGG + Exonic
1030837531 7:114308058-114308080 TGGAGTGAAAGCAACAATCCCGG - Intronic
1033273705 7:139955624-139955646 TGGAGTCATCGCAGCGCCCCGGG - Intronic
1035567236 8:649775-649797 TGGAGACAGAGCAGCCGCACAGG + Intronic
1038492581 8:27981431-27981453 TGGAGGGACAGGAGCAGCCCTGG + Intronic
1039646424 8:39289621-39289643 TGGAGCAACAGCAGCAGCCCAGG - Intergenic
1039792415 8:40886400-40886422 TGGAGTCCTGGCTGCAGCCCAGG + Intronic
1040862648 8:52015740-52015762 GGGAGTGGAAACAGCAGCCCGGG - Intergenic
1041489117 8:58411665-58411687 GGGAGACAAAGCACCAGCGCTGG - Intronic
1041597032 8:59666809-59666831 TGGAACAAAAGCAGCAGCCATGG - Intergenic
1043190870 8:77221399-77221421 TGGAGTAGAAACAGCAGACCAGG + Intergenic
1043785786 8:84398132-84398154 TGAAGTCGCAACAGCAGCCCTGG - Intronic
1044628890 8:94260438-94260460 TGCAGCCACAGCAGCAGCGCTGG - Exonic
1046124195 8:109883478-109883500 TGGAGTCAAGACAGAAGCCATGG - Intergenic
1049653785 8:143788991-143789013 TGGAGGCTGAGCAGCAGCGCCGG + Intergenic
1049797380 8:144502971-144502993 GGGAGTCCAAGTGGCAGCCCTGG - Intronic
1050612995 9:7372547-7372569 TGGAGTCATGGAAGCACCCCAGG + Intergenic
1051596445 9:18828948-18828970 TGGAATGGAAGCAGCAGCCCAGG - Intronic
1051716164 9:19987022-19987044 AGGAGTCAAAGAAGCAGAACAGG + Intergenic
1056544707 9:87604034-87604056 TGGAGTCACTGGATCAGCCCCGG - Intronic
1056802014 9:89698903-89698925 TGAAGTCAAGGGAGCTGCCCTGG - Intergenic
1056873679 9:90307313-90307335 TGCAGACAAAGCAGTAGGCCTGG + Intergenic
1057255183 9:93540624-93540646 TGGAGACACAGCACCAGGCCAGG + Intronic
1057304275 9:93903296-93903318 TGGGGTTATGGCAGCAGCCCAGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1057610748 9:96541243-96541265 TGGAATCAACACAGCAGCCCTGG + Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058704665 9:107628406-107628428 TGGAATCAAAGGACCACCCCGGG - Intergenic
1058729418 9:107835716-107835738 TGGCCCCAAAGCAGCAGGCCTGG - Intergenic
1059021306 9:110579549-110579571 TGGAGACAGAGCGGCTGCCCCGG + Exonic
1059441169 9:114307691-114307713 TGGTGTCAGAGGAGCAGCCAAGG - Exonic
1060488417 9:124064179-124064201 TGAACTCAAAGCAGCAGCTTTGG - Intergenic
1060840370 9:126788770-126788792 TGGAGATCAAGCAGCAGCCTTGG - Intergenic
1061045633 9:128163566-128163588 TGGAGTTCCAGCAGCAGCTCGGG + Exonic
1062204761 9:135329844-135329866 GGGAGTCAAAGCCGCTGTCCAGG - Intergenic
1203485574 Un_GL000224v1:50990-51012 TCAAGTCAAAGCATCAGCCCAGG - Intergenic
1189176901 X:38966606-38966628 TGCAGCTAAAGCAGAAGCCCAGG - Intergenic
1190931592 X:54953199-54953221 TGGGGTGACACCAGCAGCCCTGG + Intronic
1191975450 X:66866148-66866170 GGGAGGCAAAGCAGAAGCTCAGG + Intergenic
1196058894 X:111386362-111386384 TGGAGTCCAAGTGCCAGCCCCGG + Intronic
1196386577 X:115160528-115160550 TACAGTCAAAGTAGCAGTCCTGG + Intronic
1198006783 X:132503146-132503168 TGTAGACAAAGCATCAGTCCTGG + Intergenic
1198099496 X:133412554-133412576 GGAAATAAAAGCAGCAGCCCAGG + Intronic
1198561195 X:137851850-137851872 TGGAAAAACAGCAGCAGCCCAGG + Intergenic
1198794898 X:140384422-140384444 TGTAGTCAAAGCTACAGCCTTGG - Intergenic
1202593850 Y:26515667-26515689 TGAATTTAAAGGAGCAGCCCTGG + Intergenic