ID: 1179579555

View in Genome Browser
Species Human (GRCh38)
Location 21:42332437-42332459
Sequence TGACATCTGCTAACAGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179579555_1179579557 21 Left 1179579555 21:42332437-42332459 CCACCTGCTGTTAGCAGATGTCA No data
Right 1179579557 21:42332481-42332503 ACACAATGACTACTCTATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179579555 Original CRISPR TGACATCTGCTAACAGCAGG TGG (reversed) Intergenic
No off target data available for this crispr