ID: 1179579962

View in Genome Browser
Species Human (GRCh38)
Location 21:42336426-42336448
Sequence TCCCCGGGATCCACCTTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179579954_1179579962 13 Left 1179579954 21:42336390-42336412 CCACACGGCTCTATTTTGAATTT No data
Right 1179579962 21:42336426-42336448 TCCCCGGGATCCACCTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179579962 Original CRISPR TCCCCGGGATCCACCTTGAA GGG Intergenic
No off target data available for this crispr